VACCINE COMPOSITION INCLUDING PD-L1, KIT OF PARTS INCLUDING SUCH COMPOSITION AND USE OF THE SAME TO

专利摘要:
immunotherapy based on pd-11. The present invention relates to the field of prophylaxis and therapy of clinical conditions including cancer, autoimmune diseases and infectious diseases. in particular vaccine compositions comprising pd-11 or peptide fragments thereof which are capable of eliciting immune responses useful in the treatment of cancer, autoimmune diseases or infectious diseases are provided.
公开号:BR112014009526B1
申请号:R112014009526-4
申请日:2012-10-17
公开日:2021-07-13
发明作者:Mads Hald Andersen
申请人:Herlev Hospital；
IPC主号:

专利说明:

[001] All patent and non-patent references cited in the application, or in the present application, are also incorporated herein by reference in their entirety. FIELD OF THE INVENTION
[002] The present invention relates to the field of prophylaxis and therapy of clinical conditions including cancer, autoimmune diseases and infectious diseases. In particular there have been provided vaccine compositions comprising peptide fragments or PD-L1 thereof which are capable of eliciting immune responses useful in the treatment of cancer, autoimmune diseases or infectious diseases. BACKGROUND OF THE INVENTION
[003] The immune system has the ability to recognize and destroy neoplastic cells, however, despite the fact that neoplastic transformation is associated with the expression of immunogenic antigens, the immune system generally fails to respond effectively to these antigens. The immune system becomes tolerant of these antigens. When this happens, neoplastic cells proliferate uncontrollably leading to the formation of malignant cancers with an unfavorable prognosis for affected individuals. The acquired state of tolerance must be overcome for cancer immunotherapy to be successful.
[004] Several lines of evidence suggest that T cells are the main effectors in the immune response against cancer cells. Indoleamine 2,3-dioxygenase (IDO), cytotoxic T lymphocyte antigen 4 (CTLA-4) and programmed cell inactivation ligand 1 (PD-L1)-type immune regulatory proteins play a vital role in immune suppression and induction tolerance of anticancer immune responses. CTLA-4 is a key negative regulator of T-cell responses that can restrict the anti-tumor immune response.
[005] Recently, the anti-CTLA-4 antibody ipilimumab was approved by the FDA as well as the EMEA for the treatment of melanoma after showing an effect in clinical phase III studies. Another central mechanism for neutralizing tumor-specific immunity and preventing effective anti-cancer immunotherapy requires a specific environment in which tolerogenic dendritic cells (DC) play an essential role in shifting the immune response away from effective immunity.
[006] Programmed death 1 (PD1) is a regulatory surface molecule distributing important inhibition signals to maintain the functional silence of the T cell against its cognate antigens. Its ligands, known as PD-L1 and PD-L2, or B7-H2 are expressed in APCS, tumor cells, placental, and non-hematopoietic cells found in the inflammatory microenvironment. Interference with PD-1 or its PD-L1 ligand enhances anti-tumor immunity. It appears that up-regulation of PD-L1 is a mechanism that cancers can employ to evade the host immune system. PD-L1 expression in tumors correlated with poor clinical outcome for a variety of cancers including pancreas, kidney, ovarian, head and neck cells, and melanoma (Hamanishi et al., 2007, Proc. Natl. Acad. Sci. USA 104:3360-3365; Nomi et al., 2007, Clin. Cancer Res. 13:2151-2157; Hino et al., 2010, Cancer. 116:1757-1766. renal cell carcinoma patients found that high tumor expression of PD-L1 was associated with a high tumor aggressiveness and a 4.5-fold increased risk of death (Thompson et al., 2004, Proc. Natl. Acad. Sci. USA 101:17174-17179). Ovarian cancer patients with the highest PD-L1 expression had a significantly poorer prognosis than those with the lowest PD-L1 expression. PD-L1 expression and intraepithelial CD8+ T lymphocyte count, suggesting that PD-L1 in tumor cells can suppress CD8+ antitumor cells (Hamanishi et al., 2007, see supra). SUMMARY OF THE INVENTION
[007] The problem of cancer immunosuppression is solved by the present invention which is based on the surprising discovery by the inventors of spontaneous cytotoxic immune responses against cells expressing PD-L1 in cancer patients. These discoveries pave the way for new therapeutic and diagnostic approaches that can be generally applicable in controlling cancer diseases.
[008] Interestingly, the findings are not restricted to cancer, but are also useful in other clinical conditions characterized by the presence of undesirable cells that express PD-L1.
[009] The present invention targets cancer disease by killing cancer cells expressing PD-L1 directly and killing regulatory cells expressing PD-L1. This is done to allow T cells to recognize cells expressing PD-L1. Also, when the clinical condition is an infection, T cells are able to kill APCs/DCs expressing PD-L1.
[010] Thus, the expression of the immune suppressing enzyme PD-L1 in cancer cells and APCs is positive in conjunction with the application of the method of the present invention, which targets these cells expressing PD-L1. This approach, especially when it involves killing the APCs/Dcs, goes against common opinion in the field, where PD-L1 is usually inhibited by trial in order to remove a tolerable environment around the APCs/DCs while preserving these cells , which are considered required in order to launch an effective immune response.
[011] Furthermore, the discovery of spontaneous cytotoxic immune responses against cells expressing PD-L1 is particularly surprising as cells expressing PD-L1 antagonize the desired effects of other immunotherapeutic approaches. Therefore, a combination of tumor-targeting immunotherapies and PD-L1 is highly synergistic.
[012] The presence of a PD-L1 specific in vivo T cell response demonstrates that cancer patients are able to generate PD-L1 cell responses in vivo in response to the presence of PD-L1 peptides. In this way, the two conditions for generating a T cell response are met: T cells are present in cancer patients and they have the ability to expand, which are shown in the application as deposited. This follows from the general knowledge in the field of immunology that providing an additional PD-L1 protein or PD-L1 peptides will lead to the generation of PD-L1 specific T cell responses.
[013] In contrast to membrane-bound antibodies on B cells, which can recognize antigens alone, T cells recognize a complex ligand, comprising an antigenic peptide binding to a protein called the major histocompatibility complex (MHC). In man, this molecule is known as a human leukocyte antigen (HLA). Sample peptides from HLA Class I molecules from protein breakdown within the cell and present these on the cell surface to T cells. Therefore, this enables T cells to look for cellular changes. When a T cell encounters an antigen in the context of an HLA molecule, it undergoes clonal expansion and differentiates between memory and various effector T cells. Therefore, the identification of a spontaneous immune response is evidence that an antigen is a target T cell. This demonstrates that specific T cells have already been activated and have expanded in vivo.
[014] The ELISPOT method used in examples 1 and 3 of the present application is a very sensitive assay that demonstrates the presence of immune responses in vivo and not of simple stem cells. Also, MHC peptide tetramers have been used successfully to identify and study T cells specific for tumor associated antigens (TAA) that develop endogenously or after vaccination in patients. Tetramers have also been used to isolate and expand TAA-specific T cells for adoptive cell immunotherapy. The present application demonstrates the presence of PD-L1 tetramer-specific T cells (see Example 3) which also demonstrates a continuous PD-L1 response in vivo.
[015] The present invention relates to a vaccine composition comprising a PD-L1 of SEQ ID NO: 1 or a functional homologue thereof at least 70% identical thereto or an immunogenically active peptide fragment comprising a consecutive hair sequence at least 8 amino acids PD-L1 or such functional homologue thereof or a nucleic acid encoding such PD-L1 such functional homolog of the same or such peptide fragment; and an adjuvant for use as a medicine.
[016] The synergistic effect of a combination of vaccine-based immunotherapies disclosed above is provided in the aspect of the invention which concerns a kit of parts comprising the vaccine composition and another immunostimulating composition.
[017] The aspect of combining a vaccine of the present invention with other cancer treatments such as chemotherapeutic agents is also provided herein.
[018] The aspect of combining the vaccine of the present invention with other treatments against infections such as immunotherapies and/or antibiotics is also provided herein.
[019] It follows that a method for treating a clinical condition such as cancer or infection by any of the means described above falls within the scope of the present invention; the means include administering to an individual suffering from a clinical condition an effective amount of the vaccine composition along with another immunostimulating composition and/or a chemotherapeutic agent.
[020] It is therefore also an object of the present invention to use PD-L1 or an immunologically active peptide fragment thereof comprising a consecutive sequence of such PD-L1 or a functional homologue thereof or a vaccine composition cited above in the manufacture of a medicine for the treatment or prevention of a cancer disease. DESCRIPTION OF DRAWINGS
[021] Figure 1 shows the presence of T cell responses against PDL101, PDL111 and PDL114 as measured by ELISPOT IFN-Y. The mean of PDL specific points (after subtraction of the points without an added peptide) was calculated by 5 x 105 PBMC per each patient (white triangle). The PBMC of breast cancer patients (BC), patients with renal cell carcinoma (RCC), patients with malignant melanoma (MM) as well as healthy individuals (HD) were analyzed. T cells were stimulated once with a peptide before being plated at 5 x 105 cells per well in duplicate with both without and with the PDL1 peptide.
[022] Figure 2 shows the presence of T cell response against PDL101 as measured by ELISPOT: (a), The mean of PDL-101 specific points (after subtraction of points without the added peptide) was calculated by 5 x 105 PBMC for each patient (white triangle). The PBMC of breast cancer patients (BC), patients with renal cell carcinoma (RCC), patients with malignant melanoma (MM) as well as healthy individuals (HD) were analyzed. PMBC was isolated and plated at 5 x 105 cells per well in duplicate directly ex vivo in duplicates both without and with the PDL101 peptide. (b), T cell response against PDL101 as measured by ELISPOT TNF-α. The mean of PDL specific points (after subtraction of the points without an added peptide) was calculated by 5 x 105 PBMC per each patient (white triangle). The PBMC of breast cancer patients (BC), patients with renal cell carcinoma (RCC), patients with malignant melanoma (MM) as well as healthy individuals (HD) were analyzed. T cells were stimulated once with a peptide before being plated at 5 x 105 cells per well in duplicate with both without and with the PDL101 peptide.
[023] Figure 3 shows the functional capacity of PDL101-specific T cells: (a), Lysis by a T cell mass culture of T2 cells pulsed with either PDL101 peptide (red) or an irrelevant peptide (blue) (HIV- 1 in476-484) different effectors for targeting indices as measured by the 51Cr release assay. (b), Lysis of the breast cancer cell line MDA-MB-231 by a T cell mass culture in different effectors to target indices as measured by the 51Cr release assay.
[024] Figure 4 shows the natural T cell responses against PD-L1. (A), T cell responses against the peptide PD-L101(PDL115-23; LLNAFTVTV) as measured by ELISPOT IFN-Y. Examples of ELISPOT responses against PD-L101 for one patient with renal cell carcinoma (RCC) and two patients with malignant melanoma (MM). (B), In total, PBMC from 23 cancer patients and 24 healthy donors were stimulated once with peptide and screened for responses against PD-L101 using the ELISPOT IFN-Y. The average of PD-L101 specific points (after subtracting the points without adding peptide) calculated by 5 x 105 PBMC for each patient. A Mann-Whitney test elucidated a p value = 0.06 with a higher frequency of PD-L101-specific T cell responses in cancer patients compared to healthy donors (C). Examples of IFN-y ELISPOT in response to PD-L101 (black bars) or no peptide (grey bars) in PBMC from six melanoma patients (MM.03, MM.04, MM.05, MM.13, and MM.135), a patient with breast cancer (CM.21), and a patient with renal cell carcinoma (RCC.46). (D), TNF-α ELISPOT in response to PD-L101 (black bars) or without peptide (grey bars) in PBMC from six melanoma patients (MM.03, MM.04, MM.05, MM.13, and MM.19), one patient with breast cancer (CM.21), and one patient with renal cell carcinoma (RCC.46). All experiments were performed in triplets and a distribution-free resampling (DFR) test confirmed significant responses against PD-L101.
[025] Figure 5 shows T cell responses against PD-L1 ex vivo. (A), Examples of a T cell response against the PD-L101 peptide (PDL115-23; LLNAFTVTV) as measured by ELISPOT IFN-Y ex vivo in a melanoma patient (MM.03). (B), Ex vivo IFN-Y ELISPOT in response to PD-L101 (black bars) or no peptide (grey bars) in PBMC from two patients with malignant melanoma (MM.03 and MM.04) and one patient with renal cell carcinoma (RCC.46). All experiments were performed in triplets and a distribution-free resampling (DFR) test confirmed significant responses against PD-L101. (C), ELISA analysis of UV sensitive ligand (KILGFVFJV) exchanged with various peptides: CMV/HLA-A2 (pp65 pos495-503; NLVPMVATV), HIV/HLA-A2 (po1476-484; ILKEPVHGV) and PD-L101 (PDL115-23; LLNAFTVTV), Non-UV (not exposed to UV light) and no peptide (no rescuing the peptide). (D), PD-L101 specific T cell tetramer analysis; two examples of PD-L101 specific CD8 T cells between PBMC from breast cancer patients (CM.21) (top) and a malignant melanoma patient (MM.05) (bottom) visualized by a cytometric staining of flow using HLA-A2/PD-L101-PE, HLA-A2/HIV-PE tetramers as well as CD8-Pacfic Blue/APC allophycocyanin antibody. Dyes were performed directly in ex vivo (left), after one in vitro peptide stimulation (middle) and after three peptide stimulations (right).
[026] Figure 6 shows the cytotoxic functionality of PD-L1 specific T cells. (A), 51 Cr release assay representing % lysis of T2 cells pulsed with PD-L101 peptide (PDL115-23) or an irrelevant HIV peptide (HIV-1 pol476-484) per CM T cell culture. 21 after the third peptide stimulation. (B), Lysis of T2 cells pulsed with PD-L101 peptide (PDL115-23) or an irrelevant HIV peptide (HIV-1 po1476-484) by MM.05 T cell culture after three peptide stimulations. (C), Cytolytic responses against PD-L101 as measured by GrB ELISPOT. GrB ELISPOT responses are shown in response to PD-L101 (black bars) or no peptide (grey bars) in PBMC from three melanoma patients (MM.03, MM.53 and MM.135). All experiments were performed in triplet and the distribution-free resampling (DFR) test showed significant responses against PD-L101 in two of the patients.
[027] Figure 7 shows the cytolytic activity of PD-L1 cancer cells. (A), Lysis of the melanoma cell line HLA-A2+ MM.06 (left) or MM.07 (right) with or without IFN-Y treatment by a PD-L101 specific T cell culture (CM.21) in a different effector to target proportions as tested by 51Cr release. (B), Histograms showing PD-L1 surface expression in MM.07 and MM. 06 with or without IFN-y treatment. (C), Lysis of melanoma cell lines HLA-A2+ (squares) or MM.07 (circles) by T cell culture enriched with PD-L101.
[028] Figure 8 shows the PD-L1-dependent lysis of dendritic cells. (AB), lysis percentage of mDC without siRNA (black circles), siRNA transfected mDC against PD-L1 (0.05 nmol (black squares), 0.10 nmol (black stars) and 0.25 nmol (triangles) black)) and with control siRNA (white circles) by a PD-L1 specific T cell culture (top). C), flow cytometry analysis showing the surface expression profile of PD-L1 in mDC without transfection and mDC transfected with siRNA against PD-L1 at three different concentrations (0.05 nmol, 0.10 nmol and 0, 25 nmol) and control siRNA-transfected DC.
[029] Figure 9 shows an independent cross-sectional presentation of TAP by non-professional antigen presenting cells. (A), HLA-A2+ EBV transfected B cell line (KIG-BCL) pulsed with peptide PD-L101 (PDL115-23) (black squares), PDLong1 (PD-L19-28; FMTYWHLLNAFTVTVPKDL) (black stars), PDLong2 (PDL1242-264; VILGAILLCLGVALTFIFRLRKG) (black triangles), PD-L1 protein (white squares), or an irrelevant HIV peptide (HIV-1 po1476-484) (grey circles) by a PD-L101 specific T cell culture as measured by standard 51Cr release (B), T2 cell lysis pulsed with peptide PD-L101 (PDL115-23) (black squares), PDLong1 (PD-L19-28; FMTYWHLLNAFTVTVPKDL) (black stars), PDLong2 (PDL1242-264 ; VILGAILLCLGVALTFIFRLRKG) (black triangles), PD-L1 protein (white squares), or an irrelevant HIV peptide (HIV-1 po1476-484) (grey circles) by a PD-L101 specific T cell culture as measured by 51Cr release standard (C), HLA-A2 restricted inactivation by PD-L1 specific T cells was assessed by lysis of T2 cells pulsed with antibody blocking PDL ong1 or PDLong1+HLA-A2. (D), Histograms showing PD-L1 surface expression in KIG-BCL and T2 cell lines. DETAILED DESCRIPTION OF THE INVENTION
[030] It is a major objective of the present invention to provide a vaccine composition comprising PD-L1 or an immunologically active polypeptide fragment thereof for use as a medicine in preventing, reducing the risk of, or treating a clinical condition, where such a clinical condition is preferably selected from a group consisting of cancer, infectious diseases and autoimmune diseases. DEFINITIONS
[031] Adjuvant: any substance whose mixture with PD-L1 or an immunologically active peptide fragment thereof after administration to an individual increases the immune response to PD-L1 or such peptide fragment thereof. Preferably such an individual is a human being and preferably such an immune response is a T cell response.
[032] Antibody: the immunoglobulin molecules and active parts of the immunoglobulin molecules. Antibodies are for example intact immunoglobulin molecules or fragments thereof retaining immunological activity.
[033] Antigen: any substance that can bind to an immune receptor distributed by cloning (B cell or T cell receptor). Usually a peptide, a polypeptide or a multimeric polypeptide. Antigens are preferably capable of eliciting an immune response.
[034] APC: antigen-presenting cells. An APC is a cell that displays MHC-complexed external antigens on its surface. T cells can recognize this complex using their T cell receptor (TCR). APCs cover two categories: professional (in which there are three types: dendritic cells, macrophages and B cells) or non-professionals (they do not constitutively express the highest histocompatibility of complex proteins required for interaction with simple T cells; these are expressed only after stimulation of non-professional APC by certain cytokines such as IFN-Y).
[035] Boost: boost by a booster shot or a dose is to give an additional dose of an immunizing agent, such as a vaccine, given at a time after the initial dose to support the immune response elicited by the previous dose of the same agent.
[036] Cancer: here any pre-neoplastic or neoplastic disease, benign or malignant, where “neoplastic” refers to an abnormal proliferation of cells.
[037] Carrier: entity or compound to which antigens are coupled to help in inducing an immune response.
[038] Chimeric protein: a genetically engineered protein that is encoded by a nucleotide sequence made by joining together two or more partial or complete genes or a series of (non-)random nucleic acids.
[039] Clinical condition: a condition that requires medical attention, here especially conditions associated with the expression of PD-L1. Examples of such conditions include cancer, infectious diseases or autoimmune diseases.
[040] CTL: cytotoxic T lymphocyte. A subset of T cells expressing CD8 together with the T cell receptor and therefore able to respond to antigens presented by class I molecules.
[041] Cytokines: modulator of differentiation or growth, used in a manner not determined herein, and should not limit the interpretation of the present invention and the claims. In addition to cytokines, adhesion or accessory molecules, or any combination thereof, can be employed alone or in combination with other cytokines.
[042] Delivery vehicle: an entity by which a nucleotide sequence or polypeptide or both can be transported from at least one medium to another.
[043] DC: Dendritic cell. (DCs) are immune cells and form part of a mammalian immune system. Its main function is to process the antigen material and present it on the surface to the other cells of the immune system, thus functioning as antigen presenting cells (APCs).
[044] Fragment: is used to indicate a non-full length part of a nucleic acid or polypeptide. Thus, a fragment is itself a nucleic acid or a polypeptide, respectively.
[045] Functional homologue: A functional homolog may be any polypeptide that exhibits at least some sequence identity with a wild-type polypeptide and has retained at least one aspect of the functionality of the wild-type polypeptide. Here the functional homolog of PD-L1 has the ability to induce a T cell immune response to cells expressing PD-L1.
[046] Individual: generally any species or subspecies of bird, mammal, fish, amphibian, or reptile, preferably a mammal, more preferably a human.
[047] Infection: here the term “infection” refers to any type of medical condition giving rise to an immune response and therefore includes infections, chronic infections, autoimmune conditions and allergic inflammation.
[048] Isolated: used herein in connection with the nucleic acids, polypeptides, and antibodies disclosed herein, "isolated" refers to these having been identified and separated and/or recovered from a component of their typically cellular, natural environment . Nucleic acids, polypeptides, and antibodies of the invention are preferably isolated, and vaccines and other compositions of the invention preferably comprise isolated nucleic acids, polypeptides or isolated antibodies.
[049] MHC: Major histocompatibility complex, two major subclasses of MHC, there is Class I and Class II.
[050] Construction of nucleic acid: a genetically engineered nucleic acid. Typically comprising various elements such as genes or fragments thereof, promoters, enhancers, terminators, polyA ends, linkers, polylinkers, operative linkers, multiple cloning sites (MCS), markers, codons, other regulatory elements, internal ribosome entry sites (IRES) or others.
[051] Pathogen: a specific causative agent of disease, especially a biological agent such as a virus, a bacterium, or a parasite that can cause a disease to its host, also referred to as an infectious agent.
[052] PBMC: A Peripheral Blood Mononuclear Cell (PBMC) is a blood cell having a round nucleus, such as a lymphocyte or a monocyte. These blood cells are a critical component in the immune system to fight infection and adapt to intruders. The lymphocyte population consists of T cells (CD4 and CD8 positive - 75%), B cells and NK cells (-25% combined).
[053] Pharmaceutical carriers: also called excipients, or stabilizers, are not toxic to the cell or the individual being exposed to it in the dosages and concentrations employed. Generally the physiologically acceptable carrier is an aqueous pH buffered solution. Examples of physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight polypeptides (less than about 10 residues); proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; against salt forming ions such as sodium; and/or nonionic surfactants such as TWEEN.TM., polyethylene glycol (PEG), and PLURONICS.TM.
[054] Plurality: at least two.
[055] Promoter: a binding site on a strand of DNA to which RNA polymerase binds to initiate transcription of messenger RNA by one or more nearby structural genes.
[056] Treg: T cells / regulatory T lymphocytes.
[057] Vaccine: A substance or composition capable of inducing an immune response in an animal. Vaccines are also referred to as “vaccine compositions” or as “immunogenic compositions” in the present context. Such an immune response is according to the present invention preferably a T cell response. A vaccine of the present invention can be given as a therapeutic and/or prophylactic medicine.
[058] Variant: A 'variant' of a given nucleic acid or a polypeptide refers to a nucleic acid or a peptide that exhibits a certain degree of sequence identity to such a reference nucleic acid, but is not identical to such a nucleic acid. nucleic acid or polypeptide. PD-L1
[059] PD-L1 according to the present invention is a "Programmed Cell Death 1" ligand. Human PD-L1 is a PD-L1 expressed at high levels in cancer cells as well as in regulatory T cells. Therefore, the vaccine compositions according to the present invention are useful for the prophylaxis and/or treatment of clinical conditions characterized by the presence of unwanted cells expressing high levels of PD-L1.
[060] Therefore, not only cancer, but infections in general and infections, especially chronic infections as well as autoimmune diseases are all clinical conditions of relevance to the present invention.
[061] Since T cells expressing PD-L1 antagonize the desired effects of other immunotherapeutic approaches, targeting cells expressing PD-L1 for example by vaccination, they are therefore highly synergistic in action with an additional anticancer immunotherapy. In the present disclosure it is demonstrated that the defined PD-L1 epitopes of CLT are widely applicable in therapeutic vaccinations and are, therefore, of substantial immunotherapeutic value.
[062] It is therefore an aspect of the present invention to provide a vaccine composition comprising a PD-L1 or an immunologically active polypeptide fragment herein for use as a medicament for the treatment of a clinical condition. Such a clinical condition may be a cancer, and it is another aspect of the present invention to prevent, reduce the risk of, or treat a cancer. Another aspect concerns the use of a vaccine composition of the present invention in combination with other drugs such as immunotherapeutic drugs and/or chemotherapeutic agents. A further aspect relates to the use of a vaccine composition as disclosed herein for the treatment of diseases of viral and/or microbial origin and further to the use of such a vaccine in combination with other drugs such as immunotherapeutic drugs and/or antibiotics and/or antiviral agents.
[063] The vaccine compositions according to the present invention comprise a PD-L1 or an immunologically active peptide fragment thereof for use in the treatment of a clinical condition in an individual in need thereof. Preferably, such PD-L1 is PD-L1 from species of such individual. Thus, if the individual in need thereof is a specific type of mammal, such PD-L1 is preferably a PD-L1 of such a specific type of mammal. In a preferred embodiment of the present invention the vaccine compositions comprise a human PD-L1 of SEQ ID NO: 1 or an immunologically active peptide fragment thereof. Natural-type, i.e., naturally occurring, human PD-L1 without a mutated version of the polypeptide is identified in SEQ ID NO:1.
[064] However, in certain embodiments of the invention the vaccine compositions of the invention comprise a functional homologue of PD-L1 or an immunologically active peptide fragment thereof as defined herein below.
[065] The present invention further relates to vaccine compositions comprising an adjuvant and: i) PD-L1 of SEQ ID NO: 1; or ii) An immunologically active peptide fragment of PD-L1 of SEQ ID NO: 1; or iii) A functional homolog of PD-L1 of SEQ ID NO: 1 at least 70% identical thereto; or iv) An immunologically active peptide fragment of a functional homolog of PD-L1 of SEQ ID NO: 1 at least 70% identical thereto, where such immunologically active peptide fragment is an immunologically active peptide fragment of PD-L1 of the SEQ ID NO: 1; where a maximum of three amino acids have been replaced, or v) A nucleic acid encoding any one of i) to iv)
[066] The term peptide fragment is used here to define any non-full length (when compared to SEQ ID NO: 1) chain of amino acid residues that are directly derived from or synthesized to be identical with a consecutive chain of amino acid residues from SEQ ID NO: 1.
[067] A functional homolog can be defined as a full length or a fragment of PD-L1 that differs in sequence from wild-type PD-L1, such as the wild-type human PD-L1 of SEQ ID NO: 1 , but still able to induce an immune response against PD-L1 expressing cells such as cancer cells and DCs. The PD-L1 expressed in these cells can be natural type or endogenously mutated (such as a congenital mutation or a mutation induced during cell division or otherwise). A functional homolog can be a mutated version or an alternative spliced variant of wild-type PD-L1. In another aspect, functional homologues of PD-L1 are defined as described herein below. A functional homolog can be, but is not limited to, a recombinant version of a full-length or fragmented PD-L1 with one or more mutations and/or one or more sequence deletions and/or additions introduced ex vivo.
[068] A functional homolog of PD-L1 can be any protein/polypeptide that exhibits at least some sequence identity with SEQ ID NO: 1 and has the ability to induce an immune response in cells expressing PD-L1.
[069] Thereby the functional homologue of PD-L1 according to the present invention preferably shares at least 70% sequence identity with the PD-L1 of SEQ ID NO: 1, and therefore, the functional homolog preferably has at least 75% sequence identity, for example at least 80% sequence identity, such as at least 85% sequence identity, for example at least 90% sequence identity, such as at least 91% identity of sequence, for example, at least 91% sequence identity, such as at least 92% sequence identity, for example, at least 93% sequence identity, such as at least 94% sequence identity, per example, at least 95% sequence identity, such as at least 96% sequence identity, e.g., at least 97% sequence identity, such as at least 98% sequence identity, e.g., 99% of string identity with the string of Human PD-L1 of SEQ ID NO:1 and has the ability to induce an immune response to cells expressing PD-L1.
[070] The sequence identity according to the present invention is determined over the entire reference sequence, and thus, the sequence identity for SEQ ID NO:1 is determined over the full length of SEQ ID NO:1. Sequence identity can be calculated using a number of well-known algorithms and applying a number of different space penalties. Sequence identity is calculated relative to the full length of SEQ ID NO: 1. Any sequence alignment tool, such as, but not limited to, FASTA, BLAST, or LALIGN can be used to search for homologues and calculate sequence identity. In addition, sequence alignments can be performed using an average of penalties for space gaps and extensions. For example, the BLASt algorithm can be used with a gapping penalty in the range 5-12, preferably 8, and a gapping penalty in the range 1-2, preferably 1.
[071] Functional equivalents may further comprise chemical modifications such as ubiquitination, labeling (for example, with radionucleotides, various enzymes, etc.), pegylation (derivation with polyethylene glycol), or by insertion (or replacement by chemical synthesis) of amino acids (amino acids) such as ornithine, which does not normally occur in human proteins, however, it is preferred that the functional equivalent does not contain the chemical modifications.
[072] Any changes made in the amino acid residue sequence compared to that of the PD-L1 of SEQ ID NO: 1 are preferably conservative substitutions. One skilled in the art will know how to make and evaluate 'conservative' amino acid substitutions, whereby one amino acid is replaced by another with one or more physical and/or chemical characteristics. Conservative amino acid substitutions are less likely to affect protein functionality. Amino acids can be grouped according to shared characteristics. A conservative amino acid substitution is a substitution of one amino acid within a predetermined group of amino acids for another amino acid within the same group, where amino acids within the predetermined groups exhibit similar or substantially similar characteristics.
[073] The immunologically active peptide fragment of PD-L1 or a functional homologue thereof to be used with the invention may be of any desired length. In a specific embodiment, the immunologically active peptide fragment of the invention consists of 50 amino acid residues or less, for example, at most 45 amino acid residues, such as at most 40 amino acid residues, for example, at most 35 amino acid residues. amino acids, such as at most 30 amino acid residues, for example, at most 25 amino acid residues, such as 18 to 25 consecutive amino acids of PD-L1 as defined in SEQ ID NO: 1 or a functional homologue thereof; the functional homolog being one where at most three amino acids have been replaced, such as two amino acids, such as one amino acid having been replaced by another amino acid, preferably by a conservative substitution.
[074] Therefore in another specific embodiment the immunologically active peptide fragment of the invention consists of a maximum of 25 amino acid residues, such as a maximum of 24 amino acid residues, such as a maximum of 23 amino acid residues, such as a maximum of 22 amino acid residues. amino acids, such as at most 21 amino acid residues, such as at most 20 amino acid residues, for example, at most 19 amino acid residues, such as at most 18 amino acid residues, for example, at most 17 amino acid residues, such such as at most 16 amino acid residues, for example, at most 15 amino acid residues, such as at most 14 amino acid residues, for example, at most 13 amino acid residues, such as at most 12 amino acid residues, for example, in the maximum 11 amino acid residues, such as 8 to 10 consecutive amino acids of PD-L1 of SEQ ID NO: 1 or a functional homologue thereof; the functional homolog being one where at most two amino acids, such as one amino acid, has been replaced, preferably by a conservative substitution. Preferably, the peptide comprises at most 10 consecutive amino acid residues of PD-L1 of SEQ ID NO:1, such as 9 consecutive amino acid residues, such as 8 consecutive amino acid residues, such as 7 consecutive amino acid residues of PD-L1 as identified in SEQ ID NO: 1 or a functional homolog thereof; the functional homolog being one where at most two amino acids, such as one amino acid has been replaced by another amino acid, preferably by a conservative substitution.
[075] Therefore, in some embodiments the immunologically active peptide fragments of the invention are nonapeptides (peptides comprising 9 amino acid residues), and some decapeptides (comprising 10 residues).
[076] In a preferred embodiment of the invention the immunologically active peptide fragment comprises a peptide selected from a group consisting of peptides listed in Table 1, more preferably a peptide selected from a group consisting of the group of SEQ ID NO: 2, 12 and 15. Preferably, such immunologically active peptide fragment consists of a maximum of 25 amino acid residues, such as a maximum of 24 amino acid residues, such as a maximum of 23 amino acid residues, such as a maximum of 22 amino acid residues, such as at most 21 amino acid residues, such as at most 20 amino acid residues, for example, at most 19 amino acid residues, such as at most 18 amino acid residues, for example, at most 17 amino acid residues, such as in maximum 16 amino acid residues, for example, at most 15 amino acid residues, such as at most 14 amino acid residues, for example, at most 13 residues of amino acids, such as at most 12 amino acid residues, for example, at most 11 amino acid residues, such as 10 amino acids, for example 9 amino acids, and comprises a peptide sequence selected from a group of peptides listed in Table 1, more preferably a peptide selected from the group consisting of the group of SEQ ID NO: 2, 12 and 15.
[077] In a most preferred embodiment of the invention such immunologically active peptide fragment is selected from a group consisting of the peptides listed in Table 1, and more preferably selected from a group consisting of SEQ ID NO: 2, 12 and 15. Table 1


[078] Other immunologically active peptide fragments of the invention comprise (or more preferably consist of) between 4 and 120, preferably between 8 and 100, more preferably between 10 and 75, even more preferably between 12 and 60, even more preferably between 15 and 40, such as between 18 and 25 contiguous amino acids of PD-L1 of SEQ ID NO: 1, where at most three amino acids compared to PD-L1 sequence of SEQ ID NO: 1 have been substituted, deleted or added, such as two amino acids has been substituted, deleted or added, or an amino acid has been substituted, deleted or added.
[079] Thus, in an embodiment of the present invention, the vaccine composition comprises an immunologically active peptide fragment consisting of a consecutive sequence of PD-L1 of SEQ ID NO: 1 in the range of 8 to 50 amino acids, preferably in the range from 8 to 10 or from 20 to 25 amino acids, where a maximum of three amino acids have been substituted, and where the substitution is preferably conservative. MHC
[080] There are two types of MHC molecules; class I MHC molecules and class II MHC molecules. Class I MHC molecules are recognized by CD8 T cells, which are the main effector cells of the adaptive immune response. Class II MHC molecules are primarily expressed on the surface of antigen-presenting cells (APCs), the most important of which appears to be dendritic cells. APCs stimulate simple T cells as well as other cells in the immune system. They stimulate both CD8 T cells and CD-4 T cells.
[081] In one embodiment, novel class I MHC restricted peptide fragments consisting of 8-10 amino acids from PD-L1 of SEQ ID NO: 1 or a functional homologue thereof, where at most two amino acids of SEQ. ID NO: 1 have been substituted, which are characterized by having at least one of several characteristics, one of which is the ability to bind HLA class I molecule which is restricted in an affinity as measured by the amount of peptide it is capable of. a recovery of half the maximum value of the HLA class I molecule (C50 value) which is at most 50 µM as determined by the binding assay set-up as described herein. This assembly assay is based on stabilization of the HLA molecule after loading the peptide to the defective T2 peptide transporter line. Subsequently, correctly folded stable HLA heavy chains are immunoprecipitated using conformation-dependent antibodies, and peptide binding is quantified. Peptides of this embodiment comprise (or more preferably consist of) at most 200, preferably at most 100, more preferably at most 50, even more preferably at most 25, even more preferably at most 20, even more preferably at most 15, such as at most 10, for example in the range of 8 to 10 contiguous amino acids of PD-L1 of SEQ ID NO 1 or a functional homologue thereof where at most two amino acids of SEQ ID NO 1 have been substituted.
[082] This assay provides a simple means of screening candidate peptides for their ability to bind to a given HLA allele molecule at the above affinity. In preferred embodiments, the peptide fragment of the invention in one having a C50 value, which is at most 30 µM, such as a C50 value, which is at most 20 µM, including C50 values of at most 10 µM, at most 5 µM and maximum 2 µM.
[083] In another preferred embodiment, novel PD-L1 class II MHC restricted peptide fragments of SEQ ID NO 1 or a functional homologue thereof, where at most two amino acids of SEQ ID NO 1 have been substituted, are provided (also referred to herein as "peptides"), which are characterized by having at least one of several characteristics described herein below. Peptides of this embodiment comprise (or preferably consist of) between 4 and 120, preferably between 8 and 100, more preferably between 10 and 75, even more preferably between 12 and 60, even more preferably between 15 and 40, such as between 18 and 25 contiguous amino acids of PD-L1 of SEQ ID NO 1 of SEQ ID NO 1 or a functional homologue thereof, where at most two amino acids of SEQ ID NO 1 have been substituted.
[084] Thereby, novel 8-10 amino acid class I MHC restricted peptide fragments or novel 18-25 amino acid MHC class II restricted peptide fragments of PD-L1 of SEQ ID NO 1 or a functional homologue are provided thereof, where at most two amino acids of SEQ ID NO 1 have been substituted, which have been characterized by having at least one of the various characteristics described herein below, one of which is the ability to bind to class I or class II HLA molecule for which this is restricted.
[085] In particular embodiments peptide fragments are provided, which is a class I MHC restricted peptide or a class II MHC restricted peptide having at least one of the following characteristics: i) capable of eliciting cells producing INF-Y in a population PBMC from a cancer patient at a frequency of at least 20 per 105 PBMCs as determined by the ELISPOT assay, and/or ii) capable of an in situ detection in tumor tissue of CTLs that are reactive with the epitope peptide. iii) able to induce the growth of PD-L1 specific T cells in vitro.
[086] The most preferred peptides according to the present invention are those peptides capable of increasing a specific T cell response as determined by the ELISPOT assay, for example, the ELISPOT assay described in Example 1 herein below. Some peptides, although they do not bind MHC class I or class II with a high affinity, can still increase to a T cell response as determined by ELISPOT. Other peptides capable of binding MHC class I or class II with high affinity also enhance the T cell response as determined by ELISPOT. Both types of peptide are preferred peptides according to the invention.
[087] Therefore, the preferred peptides according to the present invention are peptides capable of increasing a specific T cell response as measured by the ELISPOT assay, where more than 20 specific peptide points per 108 cells, more preferably per 107, even more preferably by 106, even more preferably by 105 cells are measured. In particular, preferred peptides according to the present invention are those peptides capable of increasing a specific T cell response of more than 20 peptide specific points per 108 PBMC, more preferably by 107, even more preferably by 106, even more preferably per 105 PBMC, as measured by the ELISPOT assay described in Example 1 including one-time peptide stimulation in vitro.
[088] The most preferred peptides according to the present invention are those peptides that are capable of eliciting a cellular immune response, preferably a T cell response in an individual suffering from a clinical condition characterized by the expression of PD-L1, the condition clinical preferably being a cancer, an autoimmune disease or an infectious disease, and more preferably a cancer.
[089] As described above, the HLA system represents the major human histocompatibility (MHC) system. Generally, MHC systems control a variety of characteristics: transplant antigens, thymus-dependent immune responses, certain complement factors, and predisposition to certain diseases. More specifically, the MHC codes for three different types of molecules, which determine the more general characteristics of the MHC. Of these molecules, class I molecules are then called HLA-A, HLA-B and HLA-C molecules that are present on the surface of more nucleated cells and thrombocytes.
[090] The peptides of the present invention are characterized by their ability to bind to (being restricted by) a particular HLA MHC class I molecule. Thus, in one embodiment the peptide is one that is restricted by the class I HLA-A MHC molecule including HLA-A1, HLA-A2, HLA-A3, HLA-A9, HLA-A10, HLA-A11, HLA-Aw19 , HLA-A23(9), HLA-A24(9), HLA-A25(10), HLA-A26(10), HLA-A28, HLA-A29(w19), HLA-A30(w19), HLA-A31 (w19), HLA-A32(w19), HLA-Aw33(w19), HLA-Aw34(10), HLA-Aw36, HLA-Aw43, HLA-Aw66(10), HLA-Aw68(28), HLA-A69 (28). The simplest designations are also used throughout the literature, where only the primary numeric designation is used, for example. HLA-A19 or HLA-A24 instead of HLA-Aw19 and HLA-A24(49), respectively. In specific embodiments, the peptide of the invention is restricted to an HLA MHC class I species selected from the group consisting of HLA-A1, HLA-A2, HLA-A3, HLA-A11 and HLA-A24. In a specific embodiment, the peptide of the invention is restricted to an HLA MHC class I HLA-A2 or HLA-A3 species.
[091] In other useful embodiments, the peptide of the invention is a peptide, which is restricted by an HLA-B MHC class I molecule including the following: HLA-B5, HLA-B7, HLA-B8, HLA-B12, HLA -B13, HLA-B14, HLA-B15, HLA-B16, HLA-B17, HLA-B18, HLA-B21, HLA-Bw22, HLA-B27, HLA-B35, HLA-B37, HLA-B38, HLA-B39 , HLA-B40, HLA-Bw41, HLA-Bw42, HLA-B44, HLA-B45, HLA-Bw46 and HLA-Bw47. In specific embodiments of the invention, class I HLA-B MHC species to which the peptide of the invention is able to bind is selected from HLA-B7, HLA-B35, HLA-B44, HLA-B8, HLA- B15, HLA-B27 and HLA-B51.
[092] In other useful embodiments, the peptide of the invention is a peptide, which is restricted by an HLA-C MHC class I molecule including, but not limited to any of the following: HLA-Cw1, HLA-Cw2, HLA- Cw3, HLA-Cw4, HLA-Cw5, HLA-Cw6, HLA-Cw7 and HLA-Cw1.
[093] In other useful embodiments, the peptide of the invention is a peptide, which is restricted by an HLA MHC class I molecule including, but not limited to any of the following: HLA-DPA-1, HLA-DPB-1, HLA-DQA1, HLA-DQB1, HLA-DRA, HLA-DRB and all alleles in these groups and HLA-DM, HLA-DO.
[094] The selection of peptides potentially having the ability to bind to a particular HLA molecule can be done by aligning known sequences that bind to a given HLA molecule to reveal there the predominance of a few related amino acids at particular positions in the peptides. Such predominant amino acid residues are also referred to herein as "anchor residues" or "anchor residue motifs". Following such relatively simple procedures based on known sequence data can be found in accessible databases, peptides can be derived from PD-L1, which are likely to bind to a specific HLA molecule. Representative examples of such analyzes for an average of HLA molecules are given in the table below: Table 2

* In one embodiment there is no specific anchor residue for this position, however, in a preferred embodiment the anchor residue is either R or A.
[095] Thus, as an example, nonapeptides potentially having the ability to bind to HLA-A3 could have one of the following sequences: Xaa-LY-Xaa-Xaa-Xaa-Xaa-Xaa-K, Xaa-LY- Xaa-Xaa-Xaa-Xaa-Xaa-Y; Xaa-L-Y-Xaa-Xaa-Xaa-Xaa-Xaa-F or Xaa-V-Y-Xaa-XaaXaa-Xaa-Xaa-K (Xaa indicating any amino acid residue). In a similar way, sequences potentially having the ability to bind to any other HLA molecule can be designed. It will be appreciated that one skilled in the art will be able to identify other "anchor residue motifs" for a given HLA molecule.
[096] The peptide of the invention may have a sequence which is a consecutive sequence of a native sequence of PD-L1 of SEQ ID NO: 1. However, peptides having a higher affinity to any given HLA molecule may be derived from such native sequence modifying the sequence by substitution, deletion or addition of at least one amino acid residue, whereby anchor residue motifs with respect to a given HLA molecule are identified.
[097] Thus, in useful embodiments, the polypeptides of the invention include peptides, the sequences of which comprise, for each of the specific HLA alleles listed in the table, any one of the amino acid residues as indicated in the table.
[098] Thus, the peptides of the invention can be any of the aforementioned peptides comprising contiguous sequences of PD-L1, where in a range from 1 to 10, preferably in the range from 1 to 5, more preferably in the range from 1 to 3, even more preferably in the range of 1 to 2, even more preferably 1 amino acid has been exchanged for another amino acid, preferably in such a way that the peptide comprises one or more, preferably all anchor residues of a given HLA specific peptide such as indicated in table 2 above.
[099] Examples of preferred HLA species to which the preferred peptides of the present invention are restricted include: an HLA MHC Class I species selected from a group consisting of HLA-A1, HLA-A2, HLA-A3, HLA -A11 and HLA-A24, most preferably the peptide is restricted by HLA-A3 or HLA-A2. Alternatively preferred HLA species include HLA-B MHC Class I selected from the group consisting of HLA-B7, HLA -B35, HLA -B44, HLA-B8, HLA-B15, HLA-B27 and HLA-B51.
[100] An approach to identifying the polypeptides of the invention includes the following steps: selecting a particular HLA molecule, eg one occurring at a high proportion in a given population, performing an alignment analysis as described above to identify the "reasons for anchor residues" in the PD-L1 protein by isolating or constructing peptides of a compatible size that comprise one or more of the identified anchor residues and testing the resulting peptides for the ability of the peptides to elicit INF-Y producing cells in a patient's PBMC population with cancer at a frequency of at least 20 per 105 PBMC as determined by the ELISPOT assay as described in Example 1 including in vitro stimulation once with peptide.
[0101] In one aspect of the present invention, peptides derived from PD-L1 longer than 8 to 10 amino acid residues are provided. Polypeptides longer than 8 to 10 amino acids are processed by the proteasome to a shorter length to bind to HLA molecules. Thus, when administered a polypeptide longer than 8 to 10 major amino acid residues, the “larger” polypeptide/protein/protein fragment/PD-L1 variant is processed into a series of smaller peptides in the cytosol by the proteasome. One advantage of using a polypeptide that can be processed by the proteasome into a variety of different smaller peptides is that more HLA classes can be targeted with a peptide than an 8 to 10 amino acid residue peptide that is restricted to a particular HLA class .
[0102] Surprisingly, some peptides of the present invention bind to MHC molecules with a sufficiently higher affinity to yield unnecessary substitutions and are ready for use as antigens as they are presented here. Preferably, the vaccine composition of the present invention comprises one or more of the following: full length PD-L1 polypeptide (SEQ ID NO: 1), polypeptide fragments herein from, functional homologues or full length PD-L1 of SEQ ID NO: 1 and immunologically active peptide fragments of PD-L1 where one or two amino acids have been substituted, added or deleted. Most preferably, the vaccine composition comprises any of the sequences listed in the sequence listing of the present disclosure. More preferably, the vaccine composition comprises the peptides PDL101 (SEQ ID NO:2), PDL111 (SEQ ID NO:12), and/or PDL114 (SEQ ID NO:15).
[0103] A significant feature of the peptide of the invention is its ability to recognize or elicit response T cells producing INF-Y, that is, cytotoxic T cells (CTLs) that specifically recognize the particular peptide in a PBMC population, in an APC or tumor/neoplastic cells from an individual suffering from a cancer and/or an infection (target cells). This activity is readily determined by subjecting an individual's PBMCs, APCs or tumor cells to an ELISPOT assay. Prior to testing, it may be advantageous to stimulate the cells to be tested by contacting the cells with the peptide to be tested. Preferably, the peptide is capable of eliciting or recognizing T cells producing INF-y at a frequency of at least 20 per 105 PBMCs as determined by the ELISPOT assay as used herein. More preferably the frequency is at least 30 per 105 PBMCs.
[0104] The ELISPOT assay represents a strong tool for monitoring PD-L1 specific T cell responses. The main implication of the findings here is that the peptides of the invention are expressed and complexed with HLA cells in cancer cells and/or APCs expressing PD-L1. This makes these cancer cells susceptible to description by CTLs and emphasizes the potential utility of PD-L1 immunization to fight cancer and infections. The presence of spontaneous CTL responses in PBMCs from renal cell carcinoma patients, melanoma patients, and breast cancer patients to HLA-restricted PD-L1-derived peptide epitopes show the immunotherapeutic potential of PD-L1 immunogenic peptides.
[0105] In an embodiment of the present invention the immunogenically active peptide fragment of the invention is capable of inducing PD-L1 specific T cells capable of killing cells, such as cancer cells expressing PD-L1. In particular it is preferred that such a peptide fragment is capable of inducing PD-L1 specific T cells capable of lysing at least 10% of cancer cells, such as MDA-MB231 cells after an in vitro co-incubation as described herein below in Example 1 and 2. ORIGIN
[0106] The protein from which the peptide can be derived can be any PD-L1 polypeptide from any animal species in which the protein is expressed. In preferred embodiments, the starting protein is from a mammalian species including rodent species, rabbits and a primate species such as humans. Based on the selected protein sequence, the peptide of the invention is derived by any appropriate chemical or enzymatic treatment of the protein starting material that results in a peptide of a compatible size as indicated above, or can be synthesized by any conventional synthetic procedures with which an expert in the art will be familiar with. More preferably, the PD-L1 polypeptide is a human PD-L1 and more preferably a human PD-L1 of SEQ ID NO: 1. INDIVIDUAL
[0107] The subject to be treated with the vaccine composition of the present invention is an individual suffering from a clinical condition. The individual is preferably from a mammalian species and more preferably a human being. The individual can be of any age, young or old, and can be either male or female. The clinical condition from which the individual suffers may be a neoplastic disease such as cancer, or an infectious disease such as an intracellular infection or a viral infection or an autoimmune disease.
[0108] One embodiment of the present invention provides a vaccine for treating, reducing the risk of, stabilizing or preventing a cancer. In another embodiment of the present invention, it provides a vaccine for treating, reducing the risk of, stabilizing or preventing a disease arising from an infection, such as an intracellular infection or a viral infection. In yet another embodiment the invention provides vaccine compositions for treating, reducing the risk of, stabilizing or preventing an autoimmune disease. CANCER
[0109] The vaccine composition of the present invention can be used to prevent, reduce the risk of or treat a clinical condition. Preferably, the clinical condition is associated with or characterized by PD-L1 expression. The PD-L1 can be PD-L1 as identified in SEQ ID NO: 1 or a homolog sharing 70% identity with SEQ ID NO: 1. It is understood here that the expression level of PD-L1 (the expression being of hnRNA, mRNA, precursor protein, processed protein, and so on) is the same as or greater than in an individual who does not suffer from such a clinical condition.
[0110] In a preferred embodiment of the invention, the clinical condition is cancer. Cancer (malignant neoplasm) is a class of diseases in which a group of cells exhibits the peculiarities of uncontrolled growth (growth and division beyond normal limits), invasion (invasion and destruction of adjacent tissues), and sometimes metastasis (propagation to other places in the body via lymph or blood). These three malignant properties of cancer differentiate them from benign tumors, which are self-limited, do not invade or metastasize. Most cancers form tumors, but some, like leukemia, don't. The term "cancer" as used herein is intended to encompass any cancer, neoplastic or neoplastic disease.
[0111] A non-limiting group of cancers given as examples of cancers that can be treated, managed and/or prevented by administering the vaccine of the present invention include: colon carcinoma, breast cancer, pancreatic cancer, ovarian cancer, cancer of prostate, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphagiosarcoma, lymphagioendothelial sarcoma, Synovioma, mesothelioma, ewings sarcoma, squamous cell carcinoma, adenocarcinoma, leiomyosarcoma of sweat gland, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadeocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonic carcinoma, Wilms' tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, c. bladder arcinoma, epithelial carcinoma, glioblastomas, neuronomas, craniopharyngiomas, vestibular schwannoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroama, oligodendroglioma, leukemia, lymphoblastoma, melanoma, acute neuroblastoma leukemia, lymphocytoma, neuroblastoma leukemia, lymphoblastoma, neuroblastoma leukemia and acute myelocytic polycythemia vera, multiple myeloma, Waldenstrom's macroglobulinemia, and heavy chain disease, acute non-lymphocytic leukemias, chronic lymphocytic leukemia, chronic myelogenous leukemia, Hodgkin's disease, non-Hodgkin's lymphomas, rectal cancer, urinary cancer, uterine cancers , oral cancer, skin cancer, stomach cancer, brain tumors, liver cancer, laryngeal cancer, esophageal cancer, breast tumors, null childhood acute lymphoid leukemia (ALL), thymus ALL, B-cell ALL, myeloid leukemia acute, myelomonocytic leukemia, acute megakaryocytoid leukemia, Burkitt's lymphoma, acute myelogenous leukemia, maternal leukemia. chronic ileloid, and T-cell leukemia, large and small non-small cell lung carcinoma, acute granulocytic leukemia, germ cell tumors, endometrial cancer, gastric cancer, head and neck cancer, chronic lymphoid leukemia, cell leukemia hairy and thyroid cancer.
[0112] In a preferred embodiment the vaccine composition according to the vaccine composition invention is capable of eliciting a clinical response in a subject, where the clinical response can be characterized by a stabilization of the disease, in a preferred embodiment the response Clinical response may be characterized by a partial response or preferentially the clinical response may be characterized by a complete remission of a cancer. Preferably, the cancer is selected from a group of: melanoma, breast cancer, ovarian cancer, lung cancer, pancreatic cancer, haematological cancers (such as leukemias), colon and kidney cell cancers, most preferably the from a group consisting of melanoma, renal cell cancer and breast cancer.
[0113] In one aspect of the invention the vaccine composition is capable of eliciting a clinical response in an individual. In one modality the clinical response can be characterized by a stable disease (no worsening or progression), in a preferred modality the clinical response can be characterized by a partial response or preferably the clinical response can be characterized by a complete remission of a cancer or infections. Clinical response can be determined as described here below.
[0114] In another aspect of the invention the vaccine composition is capable of eliciting a clinical response in a subject, where the clinical response is characterized by a decrease in the sum of the larger diameter of the larger target lesion. The decrease can be determined as described here below.
[0115] All measurable injuries of up to a maximum of five organ injuries and 10 injuries in total, representative of all organs involved, should be identified as target injuries and recorded and measured at baseline. - Target lesions should be selected based on their size (lesions with the largest diameter) and their compatibility for accurate repeated measurements (both by imaging techniques and clinically). - A sum of the Largest Diameter (LD) for all target lesions will be calculated and reported as an LD baseline sum. The baseline sum LD will be used as a reference by which to characterize the target tumor. - All injuries (or disease sites) should be identified as unintended injuries and should also be recorded in the baseline. Measurements of these lesions are not required, but the presence or absence of each should be noted throughout the follow-up.
[0116] Assessment of target lesions - Complete Response (CR): Disappearance of all target lesions - Partial Response (PR): At least a 30% decrease in the sum of the LD of the target lesions, with reference to the sum of the line of base LD - Progressive Disease (PD): At least a 20% increase in the sum of the LD of the target lesions, based on the smallest sum of LD recorded since treatment started or the appearance of one or more new lesions - Stable Disease (SD): Not enough shrinkage to qualify for PR or enough increase to qualify for PD, referenced to the smallest sum of LD since treatment started
[0117] Assessment of untargeted lesions - Complete Response (CR): Disappearance of all untargeted lesions and the normalization of the tumor marker level - Incomplete Response / Stable Disease (SD): Persistence of one or more target lesions or/and the maintenance of the tumor marker level above normal limits - Progressive Disease (PD): Appearance of one or more new lesions and/or an unequivocal progression of existing non-targeted lesions
[0118] In an embodiment of the present invention the vaccine composition comprising any of the proteins mentioned herein and/or the polypeptides is capable of causing a clinical response in the subject, where the clinical response is characterized by a decrease in the sum of the largest diameter of the larger target lesion.
[0119] It is contemplated that the vaccine composition of the invention is capable of eliciting an immune response against a cancer expressing PD-L1 of SEQ ID NO: 1 or a functional homolog thereof having at least 70% identity with SEQ PD- L1. The vaccine composition of the invention is capable of eliciting the production in a vaccinated individual of effector T cells having a cytotoxic effect against cancer cells, PD-L1 expressing APCs and/or inducing antigen-specific T cell infiltration into the stroma tumor in a subject.
[0120] In addition to their ability to produce immune responses in PBMC populations, it is also contemplated that the peptides of the invention are capable of producing a cytolytic response in situ, that is, in solid tumor tissues. This can, for example, be demonstrated by providing HLA peptide complexes, for example, being multimerized and being provided with a detectable label, and using such complexes for immunohistochemical staining to detect CTLs in a tumor tissue that are reactive with the fragments of immunologically active peptide of the invention. Therefore, another significant feature of the peptide of the invention is that it is capable of an in situ detection in a tumor tissue of CTLs that are reactive with the epitope peptide.
[0121] It is also contemplated that the peptides of the invention, in addition to their ability to bind HLA molecules resulting in the presentation of HLA complexes and peptides on cell surfaces, which complexes in part act as epitopes or targets for cytolytic T cells , can elicit other types of immune responses, such as B cell responses resulting in the production of antibodies against the complexes and/or a Delayed-Type Hypersensitivity (DTH) reaction. The last type of immune response is defined as a palpable induration and redness at the site of injection of the peptide of the invention.
[0122] It is an object of the present invention to provide a vaccine composition comprising a PD-L1 of SEQW ID NO: 1 or a functional homologue thereof having at least 70% identity with SEQ ID NO: 1 or a peptide fragment immunologically active comprising a consecutive sequence of such PD-L1 or such functional homologue thereof or a nucleic acid encoding such PD-L1 or such peptide fragment; and an adjuvant, for the prevention of, reduction in the risk of or the treatment of cancer. CANCER COMBINATION TREATMENT
[0123] In the embodiments of the invention, where the invention relates to vaccine compositions comprising PD-L1 or an immunologically active peptide fragment thereof for the treatment of cancer, it may in some cases be appropriate to combine a treatment with a composition of vaccine according to the invention with another conventional cancer treatment such as chemotherapy, radiotherapy, treatment with immunostimulating substances, gene therapy, antibody treatment using dendritic cells.
[0124] Since the elevated expression of PD-L1 in tumor cells leads to inhibition of the immune system, the combination of a PD-L1 based immunotherapy as disclosed by the present invention with a cytotoxic chemotherapy and or other anti-cancer immunotherapeutic treatment is an effective approach to treating cancer. These remedies are also referred to here as “second active ingredients”.
[0125] Examples of chemotherapeutic agents that are of relevance in relation to administration (sequentially and simultaneously) with the vaccine composition of the present invention include, but are not limited to: all trans retinoic acids, Actimide, Azacitidine, Azathioprine, bleomycin , carboplatin, capecitabine, Cisplatin, chlorambucil, cyclophosphamide, cytarabine, daunorubicin, Docetaxel, doxifluridine, doxorubicin, epirubicin, Etoposide, fludarabine, Fluorouracil, gemcitabine, hydroxyurea, idarubicin, merchlorine-methothrenicin, mitorethramine, mitorethamine, mitorethamine , Oxaliplatin, Paclitaxel, Pemetrexed, Revlimid, Temozolomide, Teniposide, Thioguanine, Valrubicin, Vinblastine, Vincristine, Vindesine and Vinorelbine. In one embodiment, a chemotherapeutic agent for use in combination with the present agent can itself be a combination of different chemotherapeutic agents. Compatible combinations include a FOLFOX and IFL. FOLFOX is a combination that includes 5-fluorouracil (5-FU), leucovorin, and oxaliplatin. IFL treatment includes irinotecan, 5-FU, and leucovorin.
[0126] Another second active ingredient can be a kinase inhibitor, to separate, combined or simultaneous use in the treatment of tumors. Compatible kinase inhibitors include those that have been shown to have antitumor activity (such as gefitinib (Iressa) and erlotinib (Tarceva) and these can be used in combination with the peptides Receptor tyrosine kinase inhibitors such as Sunitinib maleate and Sorafenib which has been shown to be effective in the treatment of renal cell carcinoma are also compatible for use as second active ingredients.
[0127] Other examples of second active ingredients are immunostimulating substances, eg cytokines and antibodies. Such cytokines can be selected from the group consisting of, but not limited to, GM-CSF, IFN type I, interleukin 21, interleukin 2, interleukin 12 and interleukin 15. The antibody is preferably an immunostimulating antibody such as anti-antibodies. CD40 or anti-CTLA-4. The immunostimulatory substance may also be a substance capable of depleting inhibitory immune cells (eg regulatory T cells) or factors, such substance may, for example, be E3 ubiquitin ligases. E3 ubiquitin ligases (the HECT, RING, and U-box proteins) have emerged as key molecular regulators of immune cell function, and each may be involved in regulating immune responses during infection by targeting specific inhibitory molecules for proteolytic destruction. Several HECT and RING E3 proteins have also now been linked to an induction and maintenance of immune self-tolerance: c-Cbl, Cbl-b, GRAIL, Itch and Nedd4 each down-regulate cell growth factor proliferation and production T.
[0128] In one embodiment, the vaccine composition of the present invention, comprising a PD-L1, any of the functional homologues thereof described herein above or any of the immunologically active peptide fragments thereof described herein above, is administered in combination with a second active ingredient, such as an immunostimulatory substance. The immunostimulatory substance is preferably an interleukin such as IL-21 or IL-2 or a chemotherapeutic agent. INFECTIOUS DISEASES AND AUTOIMMUNE DISEASES
[0129] The present invention also relates to vaccine compositions comprising PD-L1 or any of the immunologically active peptide fragments thereof described herein above for the treatment of a clinical condition, where the clinical condition may be an infection or the condition clinic may be an autoimmune disease.
[0130] The word infection as used herein refers to any type of clinical condition giving rise to an immune response, such as inflammation, and therefore includes infectious diseases, chronic infections, autoimmune conditions, and allergic inflammation. Thus, infections such as infectious diseases, chronic infections, autoimmune conditions and allergic inflammation are all clinical conditions of relevance to the present invention, and are treated in turn below.
[0131] In particular infection or autoimmune disease can be a disease associated with inflammation. Inflammation is the complex biological response of vascular tissues to a harmful stimulus, such as pathogens, damaged cells, or irritation. It is a protective attempt by the body to remove the harmful stimulus as well as initiate the healing process for the tissue. Inflammation can be classified as either acute or chronic. Acute inflammation is the body's initial response to a noxious stimulus and is achieved by increased movement of plasma and blood leukocytes into injured tissues. A cascade of biochemical events propagates and matures the inflammatory response, involving the local vascular system, the immune system, and various cells within the injured tissue. Prolonged inflammation, known as chronic inflammation, leads to a progressive change in the types of cells that are present at the site of inflammation and is characterized by the simultaneous destruction and scarring of tissue from the inflammatory process. In both cases, PD-L1 is expressed by immune system cells such as APCs and therefore infections and inflammation are clinical conditions that can be treated, prevented, or for which the risk can be reduced by administration. of the vaccine composition of the present invention. The vaccine composition preferably comprises PD-L1 or any of the immunologically active peptide fragments thereof described herein above.
[0132] Examples of disorders associated with inflammation that are of relevance to the present invention include, but are not limited to: allergic inflammations, asthma, autoimmune diseases, chronic inflammations, chronic prostatitis, glomerulonephritis, hypersensitivities, infectious diseases, heart diseases. inflammatory bowel disease, pelvic inflammatory disease, reperfusion injury, rheumatoid arthritis, transplant rejection, and vasculitis. CHRONIC INFECTIONS AND INFLAMMATIONS
[0133] In an embodiment of the present invention the clinical condition is chronic inflammation. In particular, the autoimmune disease to be treated with the vaccine compositions of the invention may be chronic inflammation. Chronic inflammation is a pathological condition characterized by concurrent active inflammation, tissue destruction, and repair attempts. Chronically inflamed tissue is characterized by infiltration of mononuclear immune cells (monocytes, macrophages, lymphocytes, and plasma cells), tissue destruction, and healing attempts, which include angiogenesis and fibrosis.
[0134] In an acute inflammation, removal of stimulus for recruitment of monocytes (which become macrophages under appropriate activation) into the inflamed tissue, and existing macrophages exit the tissue via the lymphatics. However, in chronically inflamed tissue the stimulus is persistent, and therefore monocyte recruitment is maintained, existing macrophages are trapped in place, and macrophage proliferation is stimulated (especially in atheromatous plaques).
[0135] It is an object of the present invention to provide a vaccine composition comprising PD-L1 of SEQ ID NO: 1 or a functional homologue thereof having at least 70% identity with SEQ ID NO: 1 or an active peptide fragment immunologically comprising a consecutive sequence of such PD-L1 or such functional homologue thereof, for example, any one of the immunologically active peptide fragments described herein above or a nucleic acid encoding such PD-L1 or such peptide fragment; and an adjuvant for preventing, reducing the risk of or treating an autoimmune disease, for example, treating chronic inflammation. INFECTIOUS DISEASES
[0136] The vaccine composition of the present invention can be used to prevent, reduce the risk of or treat a clinical condition. In a preferred embodiment of the invention, the clinical condition is an infectious disease. The infectious disease can be promoted by any infectious agent such as a bacteria, a virus, parasites and or fungi that are capable of inducing an increase in the expression of PD-L1 in the individual suffering from an infectious disease, preferably, the disease of infection is or is at risk of becoming a chronic disease. Therefore, it is an aspect of the present invention to provide a vaccine composition comprising PD-L1 or any of the immunologically active peptide fragments thereof described herein above for the treatment, amelioration of (decrease in severity) stabilization and/or prevention of a disease caused by an infectious agent.
[0137] An infectious disease can be caused by a virus, and viral diseases against which the vaccine composition of the present invention can be administered in the treatment of, includes, but is not limited to the following viral diseases: HIV, AIDS, Related Complex AIDS, chickenpox (varicella), common flu, cytomegalovirus infection, colorado tick fever, dengue, Ebola hemorrhagic fever, foot and mouth disease, Hepatitis, Herpes simplex, Herpes zoster, HPV (human papillomavirus), influenza (flu), fever Lassa, measles, Marburg hemorrhagic fever, infectious mononucleosis, mumps, norovirus, Polio, progressive multifocal leukoencephalopathy, rabies, rubella, SARS, smallpox (pox), viral encephalitis, viral gastroenteritis, viral meningitis, viral pneumonia, West Nile disease, and yellow fever. Preferably the vaccine composition is administered to individuals suffering from HIV/AIDS or viral infections which can cause cancer. The main viruses associated with human cancers are human papillomavirus, hepatitis B and hepatitis C virus, Epstein-Barr virus, and human T lymphotropic virus; therefore, it is an object of the present invention to be administered as a treatment or as part of the treatment of these viral infections. Most preferably, the infectious disease can be infection with a virus selected from the group consisting of HIV and hepatitis virus.
[0138] Examples of bacterial infections of relevance to the present invention include, but are not limited to: Anthrax, bacterial meningitis, botulism, brucellosis, campylobacteriosis, cat disease risk, cholera, diphtheria, epidemic typhus, gonorrhea, Impetigo, legionnaires, leprosy (Hansen's disease), leptospirosis, listeriosis, Lyme disease, Melioidosis, rheumatic fever, MRSA infection, Nocardiosis, Pertussis (VVhooping cough), Plague, pneumococcal pneumonia, psittacosis, Q fever, spotted fever (RMSF), salmonellosis, scarlet fever, Shigellosis, syphilis, tetanus, trachoma, tuberculosis, tularemia, typhoid, typhus, and urinary tract infections. It is an object of the present invention to provide a vaccine for the treatment and/or prevention and/or reduction of the risk of a bacterial infection.
[0139] It is another aspect of the present invention to provide a vaccine composition for the treatment and/or prevention and/or risk reduction of: parasitic infectious diseases such as, but not limited to: African trypanosome, amoebiasis, Ascariasis, Babesiosis , Chagas disease, Clonorchiasis, cryptosporidiosis, cysticercosis, Diphylobotriosis, Dracunculiasis, echinococcosis, Enterobiasis, Fascioliasis, Fasciolopsiasis, Filariasis, free-living amoebic infection, giardiasis, gnatostomiasis, onynococcosis, lomenolacoccosis , Pediculosis, Pinworm infection, scabies, Schistosomiasis, taeniasis, toxocariasis, toxoplasmosis, trichinosis, trichinosis, trichuriasis, Trichomoniasis and trypanosomiasis; Fungal infectious diseases, such as, but not limited to: Aspergillosis, blastomycosis, candidiasis, coccidioidomycosis, cryptococcosis, histoplasmosis, Tinea pedis; Infectious diseases caused by prions such as, but not limited to: transmissible spongiform encephalopathy, bovine spongiform encephalopathy, Creutzfeldt-Jakob disease, fatal familial Kuru insomnia, and Alpers syndrome; therefore, it is an object of the present invention to be administered as a treatment of or as part of a treatment of these infections caused by parasites, fungi or prions.
[0140] In a preferred embodiment the vaccine compositions of the invention are for the treatment of an infectious disease, which is an intracellular infection, preferably in an intracellular infection with a pathogen selected from a group consisting of L. monocytogenesis plasmodium. COMBINED TREATMENT OF INFECTIOUS DISEASE
[0141] There is provided therefor a treatment of any infectious disease by administering the vaccine composition according to the present invention may be given together with another (second) active ingredient either sequentially in any order or simultaneously or in combination with a other treatment such as antibiotic treatment, chemotherapy, treatment with immunostimulating substances, treatment using dendritic cells, antiviral agents, antiparasitic agents and so on.
[0142] Examples of a second active ingredient that can be used in the treatment of an infectious disease in combination with the vaccine of the present invention include, and are not limited to, antibiotics. The term antibiotics herein refers to substances having an antibacterial, antifungal, antiviral and/or antiparasitic activity; examples of relevance to the present invention include, but are not limited to: Amikacin, gentamicin, kanamycin, Neomycin, Netilmycin, Paromomycin, streptomycin, tobramycin, Ertapenem, Imipenem, Meropenem, chloramphenicol, fluoroquinolones, ciprofloxacin, Gatifloxacin, Gemifloxacin, levofloxacin, Lomefloxacin, moxifloxacin, Norfloxacin, ofloxacin, Sparfloxacin, Trovafloxacin, Glycopeptides, Vancomycin, Lincosamides, clindamycin, macrolides/ketolides, azithromycin, clarithromycin, Diritromycin, Cefalexin, erythromycin, Cefalexin, Cephrazine, erythromycin, Cefalexin, Cephromycin, Erythromycin cefonicide, cefotetan, cefoxitin, Cefprozil, cefuroxime, Loracarbef, Cefdinir, Cefditoren, cefixime, Cefoperazone, Cefotaxime, Cefpodoxime, Ceftazidime, ceftibutene, ceftizoxime, ceftriaxone, Cefepime, nitrosyldiazolinazole, monobactamyls, pentazines amoxicillin/clavulanate, ampici lina, Sulbactam, bacampicillin, Carbenicillin, Cloxacillin, Dicloxacillin, methicillin, mezlocillin, Nafcillin, oxacillin, penicillin G, penicillin V, Piperacillin, Piperacillin / Tazobactam, Ticarcillin, Ticarcillin / Clavulanate, Sulfon, trimethotoxin, Quintoxamine tetracyclines, Demeclocycline, doxycycline, minocycline, tetracycline, antifungals Azola Clotrimazole fluconazole, itraconazole, ketoconazole, miconazole, voriconazole, amphotericin B, nystatin, Echinocandin, caspofungin, micafungin, Ciclofulpirox, flucytosine, grisephine. Equally important are antivirals, such as Vidarabine, acyclovir, ganciclovir and Valcyte (valganciclovir), nucleoside reverse transcriptase inhibitors - analogues (NRTI): AZT (zidovudine), ddl (didanosine), DDC (zalcitabine), d4T (stavudine), 3TC (lamivudine), non-nucleoside reverse transcriptase inhibitors (NNRTI): nevirapine, delavirdine, the protease inhibitors: saquinavir, ritonavir, indinavir, nelfinavir, Ribavirin, Amantadine/rimantadine, Relenza and Tamiflu, Pleconaril, interferons.
[0143] In one embodiment, the present invention relates to a vaccine composition comprising PD-L1 of SEQ ID NO: 1, any of the functional homologues thereof described herein above, or any of the immunologically active peptide fragments thereof described herein. here above for the treatment of an infectious disease in combination with at least one antibiotic. Preferably, the vaccine composition of the present invention is used for the treatment of chronic infections, for example HIV, and therefore is used in combination with any of the antibiotics listed above such as antiviral agents. AUTOIMMUNE DISEASES
[0144] Autoimmune diseases arise when an organism fails to recognize its own constituent parts (below sub-molecular levels) as its own, which results in an immune response against its own cells and tissues. Any disease resulting from such an aberrant immune response is termed an autoimmune disease and is of relevance to the present invention.
[0145] It is an object of the present invention to provide a vaccine composition comprising the PD-L1 of SEQ ID NO: 1 or a functional homologue thereof having at least 70% identity with SEQ ID NO: 1 or any peptide fragments immunologically active PD-L1 described herein above or a nucleic acid encoding such PD-L1 or such peptide fragment; and an adjuvant, for the prevention, risk reduction of or treatment of autoimmune diseases. Such autoimmune diseases can preferably be selected from a group consisting of celiac disease, type 1 diabetes mellitus (IDDM), systemic lupus erythematosus (SLE), Sjogren's syndrome, multiple sclerosis (MS), Hashimoto's thyroiditis, Graves' disease, idiopathic thrombocytopenia purpura, and rheumatoid arthritis (RA). Preferably, the autoimmune disease is selected from the group consisting of diabetes, lupus SLE and sclerosis. COMBINED TREATMENT OF AUTOIMMUNE DISEASE
[0146] Current treatments for autoimmune disease are usually immunosuppressive, anti-inflammatory, or palliative. Non-immune therapies such as hormone replacement in the treatment of Hashimoto's thyroiditis or type 1 diabetes mellitus result in the autoaggressive response. Dietary manipulation limits the severity of celiac disease. Steroid or NSAID treatment limits the inflammatory symptoms of many diseases. Intravenous immune globulin (IVIG) preparations are used for Chronic Inflammatory Demyelinating Polyneuropathy (CIDP) and Guillain-Barré syndrome (GBS). More specific immunomodulatory therapies, such as the TNFα antagonist Etanercept, have been shown to be useful in the treatment of AR. These immunotherapy can be associated with an increased risk of side effects, such as susceptibility to infection.
[0147] Helminth therapy developed on the basis of these observations and involves inoculating the individual with a specific intestinal parasitic nematode (helminths). There are currently two closely related treatments available, inoculation with either American Necator, commonly known as hookworms, or Trichuris Suis eggs, commonly known as pig tricuid eggs. Research is available demonstrating that this approach is highly effective in treating a variety of autoimmune diseases, including Crohn's disease, ulcerative colitis, asthma, allergies, multiple sclerosis, and chronic inflammatory diseases.
[0148] In one embodiment, the vaccine disclosed herein is used in combination with a second active ingredient such as any of the aforementioned treatments and drugs against autoimmune diseases. ALLERGIC INFLAMMATION
[0149] Allergy is an immune system disorder commonly also referred to as atopy. Allergic reactions occur to substances in the environment known as allergens; these reactions are acquired, predictable and quick. Strictly, allergy is one of the four forms of hypersensitivity and is called type I (or immediate) hypersensitivity. It is characterized by the excessive activation of certain white blood cells called mast cells and basophils by a type of antibody known as IgE, resulting in an extreme inflammatory response. Common allergic reactions include eczema, hives, hay fever, asthma, food allergies, and reactions to venom from insect stings such as bees and wasps.
[0150] Allergic inflammation is an important pathophysiological feature of several deficiencies or medical conditions including allergic asthma, atopic dermatitis, allergic rhinitis, and various allergic eye diseases.
[0151] It is an object of the present invention to provide a vaccine composition comprising a PD-L1 of SEQ ID NO: 1 or a functional homologue thereof having at least 70% identity with SEQ ID NO: 1 or any peptide fragment immunologically active PD-L1 described herein above or a nucleic acid encoding such PD-L1 or such peptide fragment; and an adjuvant, for the prevention, reduction of risk of or treatment of allergic inflammation. COMBINATION TREATMENT FOR ALLERGIC INFLAMMATION
[0152] Two types of treatments are available for the treatment of allergic inflammation: pharmacotherapy and immunotherapy.
[0153] Pharmacotherapy is the use of antagonist drugs to block the action of allergic mediators, or to prevent cell activation and degranulation processes. These include antihistamines, cortisone, dexamethasone, hydrocortisone, epinephrine (adrenaline), theophylline, cromolyn sodium and antileukotrienes such as montelukast (Singulair) or zafirlukast (Accolate); anticholinergics, decongestants, mast cell stabilizers, and other compounds thought to affect eosinophil chemotaxis, are also commonly used.
[0154] Immunotherapy is desensitization and hyposensitization treatment in which the individual is gradually vaccinated with progressively higher doses of the allergen in question. A second form of immunotherapy involves the intravenous injection of monoclonal anti-IgE antibodies. A third type, sublingual immunotherapy, is an orally administered therapy that has the advantage of an oral immune tolerance to non-pathogenic antigens such as food and resident bacteria.
[0155] In one embodiment, the vaccine disclosed herein is used in combination with a second active ingredient such as any of the aforementioned drugs and treatments against allergenic inflammation. PHARMACEUTICAL COMPOSITIONS
[0156] The present invention relates to pharmaceutical compositions capable of treating, reducing the risk of and/or preventing a clinical disease associated with PD-L1 expression in an individual; in other words the terms vaccine and pharmaceutical composition are used interchangeably herein. The vaccine/pharmaceutical compositions of the present invention may be "traditional" vaccine compositions comprising antigens such as protein polypeptides and/or nucleic acid molecules. They can also be in the form of compositions comprising cells, such as modified cells originating from an individual and last processed, or to compositions comprising complex molecules such as antibodies or TCRs.
[0157] Generally, a vaccine is a substance or composition capable of inducing an immune response in an individual. The composition may comprise one or more of the following: an "active component" such as an antigen (e.g., protein, polypeptide, peptides, nucleic acids and the like), nucleic acid constructs comprising one or more antigens among other elements, cells (eg, loaded APC, T cells for adoptive transfer use), complex molecules (antibodies, TCRs and MHC complexes and more), pharmaceutical carriers, adjuvants, and carriers. In the following, the various components of a vaccine composition according to the present invention are disclosed here in greater detail.
[0158] The vaccine composition of the invention is capable of eliciting an immune response against a cancer, DC or APC expressing PD-L1 of SEQ ID NO: 1 or a functional homolog thereof having at least 70% identity with SEQ ID NO: 1, when administered to an individual suffering from a cancer and/or infection (carrying the PD-L1 expression) in a preferred modality the clinical condition is cancer. The vaccine composition of the invention is capable of eliciting production in an individual vaccinated with effector T cells having a cytotoxic effect against cancer cells, APCs and DCs expressing PD-L1 and/or inducing antigen-specific T cell infiltration into a stromal tumor in a subject. ANTIGENS AND OTHER ACTIVE COMPONENTS Protein/polypeptide/protein based vaccine compositions
[0159] The peptides of the present invention preferentially bind with a high affinity to the MHC and are ready for use as antigens as presented here. Preferably, the vaccine composition of the present invention comprises one or more of the following: PD-L1 (SEQ ID NO: 1), immunologically active peptide fragments herein, full-length and partial-length PD-L1 functional homologues, in particular any one of the fragments described here above. Most preferably, the vaccine composition comprises any of the sequences listed in the sequence listing of the present disclosure. Even more preferably, the vaccine composition comprises the peptides PDL101 (SEQ ID NO:2), PDL111 (SEQ ID NO:12), and/or PDL114 (SEQ ID NO:15).
[0160] The choice of antigen in the vaccine composition of the invention will depend on parameters determinable by one skilled in the art. As already mentioned, each of the different peptides of the invention is presented on cell surfaces by a particular HLA molecule. As such, if a subject to be treated is typed with respect to the HLA phenotype, a peptide/peptides are selected that are/are known to bind to that particular HLA molecule. Alternatively, the antigen of interest is selected based on the predominance of multiple HLA phenotypes in a given population. As an example, HLA-A2 is the most prevalent phenotype in the Caucasian population, and therefore a composition containing a peptide binding to HLA-A2 will be active in a greater proportion of that population. Furthermore, the antigens/peptides of the present invention can be modified in accordance with the anchor residue motifs shown in Table 2 to increase binding to particular HLA molecules.
[0161] The composition of the invention may also contain a combination of two or more peptides derived from PD-L1, each specifically interacting with a different population of HLA molecules in a way that covers a greater proportion of the target population. Thus, as examples, the pharmaceutical composition may contain a combination of a peptide restricted by the HLA-A molecule and a peptide by the HLA-B molecule, for example, including those HLA-A and HLA-B molecules that correspond to the predominance of the phenotypes HLA in the target population, such as, for example, HLA-A2 and HLA-B35. Additionally, the composition may comprise a peptide restricted by the HLA-C molecule.
[0162] In the case of peptide-based vaccines, epitopes can be administered in a 'MHC-ready' fashion, which allows for presentation through exogenous loading independent of antigen uptake and processing by both antigen-presenting cells. The peptides of the present invention comprise both peptides in a short 'MHC ready' form and in a long form requiring processing by a proteasome thus providing a more complex vaccine composition that can target multiple tumor antigens. The more different HLA groups are targeted by the vaccine, the greater the likelihood that the vaccine will work in diverse populations.
[0163] The present invention relates in a preferred embodiment to a vaccine composition comprising PD-L1 of SEQ ID NO: 1 or a functional homologue thereof having at least 70% identity with SEQ ID NO: 1 or a fragment an immunologically active peptide comprising a consecutive sequence of such PD-L1 or a functional homologue thereof or a nucleic acid encoding such PD-L1 or a peptide fragment; in combination with an adjuvant for use as a medicine. The vaccine composition can be administered to treat, or reduce the risk associated with a medical condition in an individual. MULTIPLE EPITOPE VACCINE COMPOSITION
[0164] The invention also relates to highly immunogenic multiple epitope vaccines. Preferably, such vaccines should be designed in a way that facilitates a simultaneous delivery of the most suitable PD-L1 derived peptides optionally in combination with other compatible peptides and/or adjuvants as described hereinafter. The present invention encompasses such multiple epitope vaccines comprising the PD-L1 derived peptides optionally in combination with other proteins or peptide fragments not belonging to or derived from PD-L1 and/or adjuvants as described hereinafter. An important factor driving the development of vaccines having more than a complex composition is the desire to target multiple tumor antigens, for example, by designing vaccines comprising or encoding a carefully selected collection of Th and CTL cell epitopes. The invention, therefore, in one aspect relates to vaccine compositions comprising both Class I and Class II restricted PD-L1 epitopes.
[0165] The peptides of the present invention thus comprise both peptides of a short 'MHC ready' form (class I restricted), and of a longer form requiring processing by the proteasome (class II restricted). Thereby, the composition according to the present invention can be provided as a multiple epitope vaccine comprising class I restricted epitopes and/or class II restricted epitopes as defined hereinafter. VACCINE COMPOSITION BASED ON NUCLEIC ACID
[0166] The vaccine composition according to the present invention may comprise a nucleic acid encoding a PD-L1 or an immunologically active peptide fragment thereof, in particular any fragments described herein above. Such nucleic acid can thus encode any of the aforementioned peptide and protein fragments. The nucleic acid can, for example, be a DNA, RNA, LNA, HNA, PNA, preferably the nucleic acid is a DNA or an RNA.
[0167] The nucleic acids of the invention can be comprised within any compatible vector, such as an expression vector. Several vectors are available and the skilled person will be able to select a vector useful for the specific purpose. The vector can, for example, be in the form of a plasmid, cosmid, a viral particle or an artificial chromosome. The appropriate nucleic acid sequence can be inserted into the vector by a variety of procedures, for example, the DNA can be inserted into an appropriate restriction endonuclease site using techniques well known in the art. In addition to the nucleic acid sequence according to the invention, the vector may furthermore comprise one or more of the signal sequences, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a sequence of transcription termination. The vector may also comprise additional sequences, such as enhancers, poly-A ends, linkers, polylinkers, operative linkers, multiple cloning sites (MCS, STOP codons, internal ribosome entry sites (I RES) and host homolog sequences for the integration or other defined elements Methods for designing nucleic acid constructs are well known in the art (see, for example, Molecular Cloning: A Laboratory Manual, Sambrook et al., eds., Cold Spring Harbor Laboratory, 2nd Edition, Cold Spring Harbor, NY, 1989). The vector is preferably an expression vector, comprising the nucleic acid operably linked to a regulatory nucleic acid sequence directing the expression of the same in a compatible cell. regulatory nucleic acid should in general be able to direct expression in a mammalian cell, preferably a human cell, more preferably. and in an antigen-presenting cells.
[0168] In a preferred embodiment the vector is a viral vector. The vector can also be a bacterial vector, such as an attenuated bacterial vector. Attenuated bacterial vectors can be used to induce permanent mucosal immune responses at sites of infection and persistence. Different recombinant bacteria can be used as vectors, for example the bacterial vector can be selected from a group consisting of Salmonella, Lactococcus and Listeria. In general, induction of immunity to the heterologous antigen HPV16 L1 or E7 can be shown, with a strong CTL induction and tumor regression in mice. The vector may further comprise a nucleic acid encoding a T cell stimulatory polypeptide. LOADED APCs
[0169] In useful embodiments an immunogenic response directed against a cancer is elicited by administering the peptide of the invention either carrying the class I or class II MHC molecules into the subject's antigen presenting cells (APCs), isolating the subject's PBMCs and incubating the cells with the peptide before injecting the cells back into the individual or isolating the individual's precursor APCs and differentiating the cells into professional APCs using cytokines and antigens before injecting the cells back into the individual.
[0170] It is therefore an aspect of the invention to provide vaccine compositions comprising antigen-presenting cells comprising PD-L1 or any immunologically active peptide fragment thereof described herein above or a nucleic acid encoding such PD-L1 or such peptide fragment immunologically active. The antigen-presenting cell can be any cell capable of presenting an antigen to a T cell. The preferred antigen-presenting cells are dendritic cells. Dendritic cells (DC) can be prepared and used in therapeutic procedures according to any compatible protocol, for example, as described herein below. It will be appreciated by one of skill in the art that the protocol can be adopted for use with individuals with different types of HLA and different diseases.
[0171] Dendritic cells (DC) can be pulsed with 50 μg/ml of HLA restricted peptide (synthesized in GMP quality) for 1 hour at 37 °C and 5 x 106 cells are administered subcutaneously on day 1 and 14, subsequent to every 4 weeks, an additional leukapheresis after 5 vaccinations. The generation of DC for clinical use and quality control can be carried out essentially as described in Nicolette et al., (2007).
[0172] Thus, in an embodiment of the present invention, a method of treating an individual suffering from a clinical condition characterized by the expression of PD-L1, preferably where the clinical condition is a cancer or an infection, is one where the peptide is administered by presenting the peptide to the subject's antigen-presenting cells (APCs) ex vivo, followed by injection of treated APCs back into the subject. These are at least two alternative ways to accomplish this. An alternative is to isolate the individual's APC and incubate (load) the class I MHC molecules with the peptide. Loading the class I MHC molecules means incubating the APCs with the peptide in such a way that the APCs with the peptide-specific class I MHC molecules will bind the peptide and thus be able to present it to the T cells. APCs are reinjected into the individual. Another alternative form builds on recent discoveries made in the field of dendritic cell biology. In this case, monocytes (being dendritic cell precursors) are isolated from an individual and differentiated in vitro into professional APC (or dendritic cells) by the use of cytokines and antigens. Subsequently, in vitro generated DCs are pulsed with the peptide and injected into the individual. ADOPTIVE TRANSFER / ADOPTIVE IMMUNOTHERAPY
[0173] An important aspect of the invention relates to culturing PD-L1 specific T cells in vitro and the adoptive transfer of these to individuals. Adoptive transfer means that the doctor directly transfers current components of the immune system that are already capable of producing a specific immune response in an individual.
[0174] It is an objective of the present invention to provide PD-L1 specific T cells, which may be useful, for example, for adoptive transfer. Isolated T cells comprising T cell receptors capable of specifically binding to PD-L1/MHC class I peptide or PD-L1/MHC class II peptide complexes can be adoptively transferred to individuals, such T cells preferably being T cells that have been expanded in vitro, where the PD-L1 peptide can be any of the PD-L1 peptides mentioned here above. In vitro T cell expansion methods are well known to the skilled person. The invention also relates to methods of treatment comprising administering T cells comprising T cell receptors capable of specifically binding the MHC-restricted PD-L1 peptide complex to an individual, such as a human suffering from cancer, where the peptide is derived. of PD-L1 can be any of the PD-L1 peptides mentioned herein above. The invention furthermore relates to the use of T cells comprising T cell receptors capable of specifically binding to PD-L1 or the peptide fragments thereof for the preparation of a medicine for the treatment of a cancer or a infection. Autologous T cell transfer can be performed essentially as described in Walter et al., (1995). TCR TRANSFER
[0175] In yet another modality, such T cells could be irradiated before adoptive transfer to control proliferation in the individual. It is possible to genetically engineer T cell specificity by TCR gene transfer (Engles et al., 2007). This allows the transfer of T cells influencing the specificity of the PD-L1 peptide in individuals. In general, the use of T cells for adoptive immunotherapy is attractive because it allows expansion of the T cells in a virus or tumor-free environment, and analysis of T cell function prior to infusion. The application of TCR gene-modified T cells (such as T cells transformed with the expression construct directing expression of a heterologous TCR) in adoptive transfer has several advantages compared to transfer of T cell lines: (i) a generation of redirected T cells is generally applicable. (ii) high affinity or very high affinity TCRs can be selected or created and used to design T cells. (iii) high avidity T cells can be generated using codon optimized or murinized TCRs allowing for better surface expression of the stabilized TCRs. Genetic projection of a T cell specificity by the gene transfer receptor (TCR) can be performed essentially as described in Morgan et al., 2006. TCR TRANSFECTION
[0176] TCR with known antitumor reactivity can be genetically introduced into primary human T lymphocytes. Genes encoding the alpha and beta TCR chains of a tumor-specific CTL clone can be transfected into primary T cells and thereby reprogram the T cells with specificity against the tumor antigen. TCR RNA is transfected into PBMC by electroporation (Schaft et al., 2006). Alternatively, T cells can be provided with new specificities by TCR gene transfer using retroviral vectors (Morgan et al., 2006). However, the provirus from a retroviral vector can be randomly integrated into the genome of transfected cells and subsequently disturb cell growth. Electroporation of T cells with RNA encoding TCR overcomes this disadvantage, as RNA is only transiently present in transfected cells and cannot be integrated into the genome (Schaft et al., 2006). Furthermore, transfection of cells is routinely used in the laboratory. ADJUVANTS AND CHARGERS
[0177] The vaccine composition according to the invention preferably comprises an adjuvant and/or a carrier. Examples of useful adjuvants and carriers are given here below. Thus, the PD-L1 of SEQ ID NO: 1, the functional homologue or the immunologically active peptide fragment thereof may in a composition of the present invention be associated with an adjuvant and/or a carrier.
[0178] Adjuvants are any substance whose mixture in the vaccine composition enhances or otherwise modifies the immune response to PD-L1 or a peptide fragment thereof, see further below. Carriers are support structures, for example a polypeptide or a polysaccharide, with which the PD-L1 or a peptide fragment thereof is able to be associated and which aid in the presentation especially of the peptides of the present invention.
[0179] Many of the peptides of the invention are relatively small molecules and may therefore be required in compositions as described herein to combine the peptides with various materials such as adjuvants and/or carriers, to produce vaccines, immunogenic compositions, etc. Adjuvants, broadly defined, are substances that promote immune responses. A general discussion of adjuvants is provided in Goding, Monoclonal Antibodies: Principles & Practice (2nd edition, 1986) at pages 61-63. Goding notes that when the antigen of interest is of a low molecular weight, or is a weak immunogen, coupling to an immunogen carrier is recommended. Examples of such carrier molecules include keyhole limpet hemocyanin, bovine serum albumin, ovalbumin and chicken immunoglobulin. Several saponin extracts have also been suggested to be useful as adjuvants in immunogenic compositions. It has been proposed to use a granulocyte-macrophage colony stimulating factor (GM-CSF), a well-known cytokine, as an adjuvant (WO 97/28816).
[0180] A carrier can be present independently of an adjuvant. The function of a carrier can, for example, be to increase the molecular weight of a particular peptide fragment in order to increase its activity or immunogenicity, to impart stability, to increase biological activity, or to increase serum half-life. In addition, a carrier can aid in presenting the PD-L1 polypeptide or such fragment thereof to T cells. The carrier can be any compatible carrier known to one of skill in the art, for example, a protein- or antigen-presenting cell. A protein carrier can be, but is not limited to, keyhole limpet hemocyanin, serum proteins such as transferrin, bovine serum albumin, human serum albumin, thyroglobulin or ovalbumin, immunoglobulins, or hormones such as insulin or palmitic acid . For the immunization of humans, the carrier must be a safe, physiologically acceptable carrier for humans. However, tetanus toxoid and/or diphtheria toxoid are compatible carriers in one embodiment of the invention. Alternatively, the carrier can be dextrans, for example sepharose.
[0181] Accordingly, it is an aspect of the present invention that the vaccine compositions comprise PD-L1 of SEQ ID NO: 1, a functional homologue thereof sharing at least 70% sequence identity or any of the active peptide fragments immunologically described herein above is associated with a carrier such as, for example, a protein of the above or an antigen-presenting cell such as, for example, a dendritic cell (DC).
The vaccine compositions of the invention generally comprise an adjuvant. Adjuvants can, for example, be selected from a group consisting of: AIK(SO4)2, AINa(SO4)2, AINH4 (SO4), silica, alum, Al(OH)3, Ca3 (PO4)2, kaolin, carbon, aluminum hydroxide, muramyl dipeptides, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-DMP), N-acetyl-normuramil-L-alanyl-D-isoglutamine (CGP 11687, also referred to as nor-MDP), N-acetylmuramiul-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP 19835A, also referred to as MTP- PE ), RIBI (MPL + TDM + CWS) in a squalene/Tween-80.RTM 2%. emulsion, lipopolysaccharides and their various derivatives, including lipid A, complete Freund's adjuvant (FCA), incomplete Freund's adjuvant, Merck Adjuvant 65, polynucleotides (eg poly IC and poly AU acids), Mycobacterial wax D, tuberculosis, substances found in Corynebacterium parvum, Bordetella pertussis, and members of the genus Brucella, Titermax, ISCOMS, Quil A, ALUN (see US 58767 and 5554372 ), lipid A derivatives, choleratoxin derivatives, HSP derivatives, LPS derivatives, matrices of synthetic peptides or GMDP, interleukin 1, interleukin 2, Montanide ISA-51 and QS-21. Preferred adjuvants to be used with the invention include oil/surfactant based adjuvants such as Montanide adjuvants (available from Seppic, Belgium ), preferably Montanide ISA-51. Other preferred adjuvants are bacterial DNA-based adjuvants, such as adjuvants including CpG oligonucleotide sequences. Still other preferred adjuvants are viral dsRNA based adjuvants such as poly I:C. Imidazoquinillines are still other examples of preferred adjuvants. The most preferred adjuvants are compatible adjuvants for human use.
[0183] Montanide adjuvants (all available from Seppic, Belgium), should be selected from a group consisting of Montanide ISA-51, Montanide ISA-50, Montanide ISA-70, Montanide ISA-206, Montanide ISA-25, Montanide ISA-720, Montanide ISA-708, Montanide ISA-763A, Montanide ISA-207, Montanide ISA-264, Montanide ISA-27, Montanide ISA-35, Montanide ISA 51F, Montanide ISA 016D and Montanide IMS, preferably from a group consisting of Montanide ISA-51, Montanide IMS and Montanide ISA-720, most preferably from a group consisting of Montanide ISA-51. Montanide ISA-51 (Seppic, Inc.) is an oil-based adjuvant/surfactant in which different surfactants are combined with a non-metabolizable mineral oil, a metabolizable oil, or a mixture of the two. They are prepared for use as an emulsion with an aqueous solution comprising PD-L1 of SEQ ID NO: 1, any of the functional homologues thereof described herein above, or any of the immunologically active peptide fragments thereof described herein above. The surfactant is a mannide oleate. QS-21 (Antigenics; Aquila Biopharmaceuticals, Framingham, MA) is a highly purified water-soluble saponin that handles as an aqueous solution. The QS-21 and ISA-51 adjuvants can be provided in sterile single-use vials.
[0184] The well-known cytokine GM-CSF is another preferred adjuvant of the present invention. GM-CDF has been used as an adjuvant for a decade and may preferably be a GM-SF as described in WO 97/28816.
[0185] It is also contemplated within the invention that vaccine compositions may comprise more than one different adjuvant and thus vaccine compositions of the invention may comprise a mixture of adjuvants mentioned hereinabove. Furthermore, it is contemplated within the present invention that both the vaccine composition as well as at least one other adjuvant may be administered to an individual in need thereof simultaneously or sequentially in any order.
[0186] The desired functionalities of adjuvants capable of being used in accordance with the present invention are listed in the table below. Table 3: Adjuvant Modes of Action
Source: Cox, JC, and Coulter, AR (1997). Vaccine 15, 248-56.
[0187] A vaccine composition according to the present invention may comprise more than one adjuvant. Furthermore, the invention encompasses a therapeutic composition further comprising any adjuvant and/or carrier substance including any of the above or combinations thereof. It is also contemplated that the PD-L1 protein, a functional homologue thereof, or any immunologically active peptide fragments thereof, and the adjuvant may be administered separately or in any appropriate sequence.
Preferably, the vaccine compositions of the present invention comprise a Montanide adjuvant such as Montanide ISA 51 or Montanide ISA 720 or the GM-CSF adjuvant or a mixture thereof.
[0189] Therefore, the invention encompasses a therapeutic composition further comprising an adjuvant substance including any of the above or combinations thereof. It is also contemplated that the antigen, i.e. the peptide of the invention and the adjuvant may be administered simultaneously or separately in any appropriate sequence. ADMINISTRATION AND DOSAGE
[0190] The amount of PD-L1 or immunologically active peptide fragment thereof in the vaccine composition may vary depending on the particular application. However, a single dose of the PD-L1 or peptide fragment thereof is preferably anywhere from about 10 µg to about 5000 µg, more preferably from about 50 µg to about 2500 µg, such as about from 100 µg to about 1000 µg. modes of administration include intradermal, subcutaneous and intravenous administration, implantation in the form of a time-release formulation, etc. Any and all forms of administration known in the art are encompassed herein. Also any conventional dosage forms that are known in the art to be suitable for formulating an injectable immunogenic peptide composition are encompassed, such as lyophilized forms and solutions, suspensions or emulsion forms containing, if required, pharmaceutically acceptable carriers, diluents , preservatives, adjuvants, buffer components, etc.
[0191] Pharmaceutical compositions can be prepared and administered using any conventional protocol known to one skilled in the art. In example 2, a non-limiting example of preparation of a vaccine composition according to the invention is given as well as a non-limiting example of administration of such a vaccine. It will be appreciated by one of skill in the art that the protocol can be readily adapted to any of the vaccine compositions described herein. In another embodiment of the invention, the pharmaceutical composition of the invention is useful for treating an individual suffering from a clinical condition characterized by PD-L1 expression, such as cancer and infections.
[0192] The immunoprotective effect of the composition of the invention can be determined using various approaches known to those skilled in the art. A successful immune response can also be determined by the occurrence of DTH reactions after immunization and/or detection of antibodies specifically recognizing the peptides in the vaccine composition.
The vaccine compositions according to the invention can be administered to a subject in therapeutically effective amounts.
[0194] Pharmaceutical compositions can be provided to an individual by a variety of routes such as subcutaneous, topical, oral or intramuscular. The administration of the pharmaceutical compositions is carried out orally or parenterally. Parenteral delivery methods include topical, intraarterial (directly into tissue), intramuscular, subcutaneous, intramedullary, intrathecal, intraventricular, intravenous, intraperitoneal, or intranasal administration. The present invention also aims to provide compatible oral and topical parenteral and systemic pharmaceutical formulations for use in methods of prophylaxis and treatment with the vaccine composition.
[0195] For example, vaccine compositions can be administered in oral dosage forms such as tablets, capsules (each including time release and sustained release formulations), pills, powders, granules, elixirs, extracts, solutions, suspensions , syrups and emulsions, or by injection. Also, they can be administered in intravenous (both bolus and infusion), intraperitoneal, subcutaneous, topical with or without occlusion, or intramuscular form, all using forms well known to those skilled in the pharmaceutical arts. An effective but non-toxic amount of the vaccine comprising any of the compounds described herein can be employed as a therapeutic or prophylactic agent. Also any and all conventional dosage forms that are known in the art to be suitable for formulating injectable immunogenic peptide compositions are encompassed, such as lyophilized forms and solutions, suspensions or emulsion forms containing, if required, the conventional pharmaceutically acceptable carriers , thinners, preservatives, adjuvants, buffer components, etc.
[0196] Preferred modes of administration of the vaccine composition according to the invention include, but are not limited to systemic administration, such as intravenous or subcutaneous administration, intradermal administration, intramuscular administration, intranasal administration, oral administration, rectal administration, administration vaginal, pulmonary administration and generally any form of mucosal administration. Furthermore, it is within the scope of the present invention that the means for any of the forms of administration mentioned herein are included in the present invention.
[0197] A vaccine according to the present invention may be administered once, or any number of times such as two, three, four or five times. In one embodiment the administration of the vaccine composition of the present invention may be administered any number of times such as once a month, for the first two years, then administered once every three months for at least two years, such as three years, four years or five years. Administering the vaccine more than once has the effect of boosting the resulting immune response. The vaccine can further be boosted by administering the vaccine in a form or part of the body different from the previous administration. The booster trigger is both a homologous and a heterologous booster trigger. A homologous booster trigger is where the first and subsequent vaccinations comprise the same structures and more specifically the same delivery vehicle especially the same viral vector. A heterologous booster trigger is when identical constructs are comprised within different viral vectors. SECOND ACTIVE INGREDIENT
[0198] It is an aspect of the present invention that the vaccine composition provided herein is used in combination with a second active ingredient. Administration of the vaccine composition and the second active ingredient can be sequential or combined. Examples of the second active ingredient are given above for both cancer and infections. It is another aspect that the vaccine composition can be used in combination with another therapy of relevance to a given clinical condition to be treated. Such therapy may include surgery, chemotherapy or gene therapy, immunostimulating substances or antibodies; one skilled in the art is able to determine the appropriate combination treatment for a given scenario.
[0199] In some cases it will be appropriate to combine the treatment method of the invention with another medical treatment such as chemotherapy, radiotherapy, treatment with immunostimulating substances, gene therapy, treatment with antibodies and/or antibiotics and treatment using dendritic cells. DIAGNOSTIC AND PROGNOSTIC TOOLS
[0200] The peptides of the present invention provide the basis to widely develop diagnostic and prognostic procedures in relation to cancer and infections. Thus, in other useful embodiments the composition of the invention is a composition for ex vivo or an in situ diagnosis of the presence of cells expressing PD-L1 in an individual. The diagnostic procedure is based on PD-L1 reactive T cells among PBMCs or in tumor tissue.
[0201] Therefore, there is provided a diagnostic kit for ex vivo or in situ diagnosis of the presence in an individual of PD-L1 reactive T cells or in tumor tissue comprising one or more peptides of the invention, and a method comprising contacting a tumor tissue or a blood sample with a complex of a peptide of the invention and an HLA class I or class II molecule or a fragment of such a molecule and detect binding of the complex to the tissue or blood cells. In one aspect, the invention provides a complex of a peptide and an HLA class I or class II molecule or a fragment of such a molecule, which is useful as a diagnostic reagent as described herein. Such a complex can be monomeric or multimeric.
[0202] Another useful prognostic or diagnostic approach is based on the generation of antibodies in heterologous animal species, for example, murine antibodies directed against human PD-L1, which can then be used, for example, to diagnose the presence of cancer cells presenting the peptide. For such immunization purposes, the amount of peptide may be less than that used in the course of in vivo therapy such as that mentioned above. In general, a preferred dose may range from about 1 µg to about 750 µg of peptide. It is also possible to produce monoclonal antibodies based on immunization with a peptide of the invention. Therefore, the present invention also relates to a molecule, in particular a monoclonal or polyclonal antibody including a fragment thereof, which is capable of specifically binding a peptide of the invention and a molecule which is capable of blocking such binding, by example, a raised antibody against a monoclonal or polyclonal antibody directed against a peptide of the invention. The invention further relates to isolated T cell receptors capable of binding especially a peptide or protein of the invention as well as isolated nucleic acids encoding the same. Such T cell receptors can, for example, be cloned from protein or peptide-specific T cells using standard techniques well known to the skilled person.
[0203] In one aspect the invention also relates to isolated T cells comprising T cell receptors capable of specifically binding to PD-L1 and/or any of the immunologically active peptide fragments thereof described herein. Isolated T cells can be CD8 T cells or CD4 T cells. Isolated T cells are preferably T cells that have been expanded in vitro. Methods for expanding T cells in vitro are well known to those skilled in the art. Such T cells may in particular be useful in the treatment of cancer by adaptive transfer or autologous cell transfer. Thus, the invention also relates to pharmaceutical compositions comprising T cells as well as methods for treatment comprising administering T cells comprising T cell receptors capable of specifically binding to PD-L1 or peptide fragments thereof to a subject, in need of the even as an individual suffering from cancer and/or infections. Transfer of autologous cells can be performed essentially as described in Walter et al., (1995).
[0204] The present invention provides the means to treat, prevent, alleviate or cure a clinical condition characterized by the expression of PD-L1 such as cancer and infections preferably a cancer, comprising administering to an individual suffering from the disease an effective amount of a composition as defined herein, a molecule that is capable of specifically binding a peptide fragment, which may, for example, be an antibody or a T cell receptor or the kit of parts described herein. Therefore, it is another aspect of the invention to provide a method of treating a clinical condition associated with the expression of PD-L1 of SEQ ID NO:1. IMMUNIZATION MONITORING
[0205] In preferred embodiments, the pharmaceutical composition of the invention is a vaccine composition. It is, therefore, of interest and an aspect of the present invention to monitor the immunization of an individual to which the vaccine composition of the present invention is administered. The vaccine composition may thus be capable of eliciting an immune response to cancer and/or infection. As used herein, the term "vaccine composition" refers to a composition eliciting at least one type of immune response directed against cells expressing PD-L1 such as cancer cells, APCs or DCs. Thus, such an immune response can be any of the following: a CTL response where CTLs are generated, and which are capable of recognizing the peptide/HLA complex displayed on cell surfaces resulting in cell lysis, i.e., the vaccine causes the production, in the vaccinated subject, of effector T cells having a cytotoxic effect against cancer cells; a B-cell response giving increased production of anti-cancer antibodies; and/or a DTH type of immune response. It is an object of the present invention to monitor the immunization of an individual by monitoring any of the above subsequent reactions to administer the composition of the present invention to such individual.
[0206] In one aspect the invention relates to methods for monitoring immunization, such method comprising the steps of i) providing a blood sample from an individual ii) providing a PD-L1 of SEQ ID NO: any of the homologs functionals thereof described herein above or any of the immunologically active peptide fragments described herein above; iii) determining whether such a blood sample comprises antibodies or T cells comprising T cell receptors specifically binding the protein or peptide iv) thereby determining whether the immune response to such protein or peptide was elevated in such individual.
[0207] The individual is preferably a human being, for example a human being who has been immunized with PD-L1 or a peptide fragment thereof or a nucleic acid encoding such a protein or peptide. PARTS KIT
[0208] The invention also relates to a kit of parts comprising - any of the vaccine compositions described herein and/or - a PD-L1 of SEQ ID NO: 1 or any of the functional homologues described herein above and/or - any of the immunologically active peptide fragments of PD-L1 described herein above, and/or - any of the nucleic acids encoding the above major colon proteins and instructions on how to use the kit of parts.
[0209] The invention also relates to a kit of parts comprising - any of the vaccine compositions described herein and/or - a PD-L1 of SEQ ID NO: 1 or any of the functional homologues thereof described herein above and/ or - any of the immunologically active peptide fragments of PD-L1 described herein above and/or - any of the nucleic acids encoding the above major colon proteins and a second active ingredient.
[0210] Preferably, the second active ingredient is chosen in correspondence with the clinical condition to be treated so that in the case where a cancer is to be treated the second active ingredient is chosen from, for example, chemotherapeutic agents as listed above. Also, when treating a viral/microbial infection, the second active ingredient is preferably an antibiotic and/or an antiviral agent.
[0211] The components of the kit of parts are preferably comprised in individual compositions, it is therefore within the scope of the present invention that all components of the kit of parts are comprised within the same composition. The kit of parts components can thus be administered simultaneously or sequentially in any order. EXAMPLES EXAMPLE 1 PATIENTS
[0212] Peripheral Blood Mononuclear Cells (PBMC) were collected from cancer patients (renal cell carcinoma, melanoma, and breast cancer) and healthy controls. Blood samples were drawn a minimum of four weeks after completion of any type of anti-cancer therapy. PBMC was isolated using an HLA-type Linfoprep separation (Department of Clinical Immunology, University Hospital, Copenhagen, Denmark) and frozen in FCS with 10% DMSO. The protocol was approved by the Scientific Ethics Committee for the Capital Region of Denmark and conducted in accordance with the provisions of the Declaration of Helsinki. A written patient briefing was obtained prior to entering the study. ELISPOT TEST
[0213] The ELISPOT assay was used to quantify peptide-specific IFN-Y releasing effector cells as previously described (Andersen et al., 2001, Cancer Res. 61:869-872). In some experiments the PBMC was stimulated once in vitro with the peptide before analyzing as described (McCutcheon et al., 1997, J Immunol Methods 210:149-166) to extend the sensitivity of the assay. Briefly, 96-well plates with nitrocellulose bottom (MultiScreen MAI P N45; Millipore) were coated overnight with IFN-y capture mAb (Mabtech). The wells were washed, blocked by an X-vivo medium and effector cells (PBMC collected and when indicated stimulated as described above) were added in duplicate at different cell concentrations, with or without 10 µM of peptide. Plates were incubated overnight. The next day, the medium was discarded and the wells were washed prior to addition of the relevant biotinylated secondary Ab (Mabtech). The plates were incubated at room temperature (RT) for 2 hours, washed, and avidin-conjugated enzyme (AP-Avidin; Calbiochem/Invitrogen Life Technologies) was added to each well. Plates were incubated at RT for 1 hour and NBT/BCIP enzyme substrate (Invitrogen Life Technologies) was added to each well and incubated at RT for 5-10 min. After the appearance of dark purple spots, the reaction was terminated by washing with running water. Spots were counted using an ImmunoSpot Series 2.0 analyzer (CTL Analyzers). ESTABLISHMENT OF ANTIGEN-SPECIFIC CLONES AND T-CELL CULTURES
[0214] The PBMC from a melanoma patient was stimulated with an irradiated (20 Gy) autologous PD-L1 peptide loaded DC (PBMC:DC ratio = 3x106: 3x105). The next day IL-7 (5ng/m1) and IL-12 (10ng/m1) (PeproTech, London, UK) were added. Stimulation of cultures was performed every 10 days with autologous irradiated DC loaded with PDL101 (2x) followed by autologous irradiated PBMC loaded with lkB10 (3x). One hundred twenty U/ml IL-2 (PeproTech, London, UK) was added after each stimulation. After one month of growth the cultures were tested for specificity in a standard 51Cr release assay. CYTOTOXITY TEST
[0215] Conventional 51Cr release assays for CTL-mediated cytotoxicity were performed as described elsewhere (Andersen et al., 1999). The target cells were T2 with or without PDL101 (figure 3a) and the breast cancer cell line HLA-A2+ the breast cancer cell line MDA-MB-231 (figure 3b) (available from the American Type Culture Collection (ATCC)). RESULTS PD-L1 AGAINST HLA-A2 RESTRICTED IMMUNE RESPONSES
[0216] The amino acid sequence of the PD-L1 protein was sorted for the most likely deca-mer and ninth HLA-A2 peptide epitopes from the specific anchor residues of HLA-A2 (see table 2). 17 peptides derived from PD-L1 were selected and subsequently synthesized. Using an ELISPOT IFN-Y secretion assay, PBMC from cancer patients and healthy individuals were examined for the presence of specific T cell responses against these PD11-derived peptides. HLA-A2+ PBMC, late stage cancer patients (breast cancer, melanoma and renal cell carcinoma) were stimulated once with different peptides in vitro prior to examination by ELISPOT. ELISPOT responses were detected against PDL101, (LLNAFTVTV; PD-L115-23, SEQ ID NO:2)), PDL111 (CLGVALTFI; PDL1250-258, SEQ ID NO:12) and PDL114 (VILGAILLCL; PDL1242-251, SEQ ID NO: 15). In addition, PBMC from healthy individuals were examined for reactivity against these three PDL1-derived peptides. The results are shown in Figure 1, which shows the PDL1 specific spots by 5x105 PBMC as determined after once in vitro stimulation with peptide as described herein above.
[0217] In addition to determining the presence of specific T cells using IFNy as a marker, TNTα was also used as a marker. Thus, an ELISPOT assay was performed essentially as described above with the PDL101 peptide including a once in vitro stimulation with such a peptide, except that TNFα antibodies were used in place of the IFNy antibodies. Figure 2B shows the results. DETECTION OF HLA-A2 REACTIVE PD-L1 REACTIVE T CELLS IN CANCER PATIENTS
[0218] While the frequency of PD-L1 reactive T cells are markedly increased by an in vitro stimulation, PD-L1 reactive T cells were also rapidly detectable ex vivo in selected patients: In six patients with strong responses after stimulation in vitro, a respective reactivity was also detected ex vivo. The results are shown in Figure 2A, which shows the PDL1 stains by 5x105 PBMC as determined on the PBMC directly after collection, ie without an in vitro stimulation. FUNCTIONAL CAPACITY OF PD-L1 SPECIFIC T CELLS
[0219] Having identified the patients harboring responses against the PD101 peptide, we used PBMC from such patients to generate the specific T cell cultures against this peptide in vitro. PBMC was stimulated by autologous PD-L1 pulsed dendritic cells (DC) as described above. After four rounds of stimulation, peptide specificity was tested in standard 51Cr release assays. To this end, both unloaded T2 cells and T2 cells loaded with lkB10 peptide served as targets. This assay revealed that only T2 cells pulsed with PD-L101 were killed (figure 3). Then, PD-L1 specific T cell cultures were further used to test the ability to kill HLA-A2 positive cancer cell lines.
[0220] Next, clones were established from T cell cultures by limiting the dilution. After a short expansion step, the specificity of growing clones was analyzed in standard 51Cr release assays. Clone 9 effectively disrupted PD-L1 pulsed T2 cells. Also clone 9 generated from specific mass cultures was able to kill MDA-MB-231 breast cancer cells. EXAMPLE 2 VACCINE COMPOSITION
[0221] 500 μg of PD-L1 peptide (PDL101, PDL111 or PDL115) in 500 μL of buffer and phosphate is mixed with 500 μL of Montanide adjuvant (Seppic, France) and administered to the patient. In addition 75 μg of Leucine (Sargramostim; GM-CSF — available from Genzyme, USA) to stimulate the immune system. Both the vaccine composition and GM-CSF are administered by subcutaneous injection. The vaccination area is in addition treated topically with Aldara (Imiquimod — available from MEDA AB, Sweden) to enhance the local immune response. EXAMPLE 3 PATIENTS
[0222] Peripheral Blood Mononuclear Cells (PBMC) were collected from healthy individuals and patients with cancer (melanoma, renal cell carcinoma and breast cancer). Blood samples were taken a minimum of four weeks after the completion of any type of anticancer therapy. PBMC were isolated using a Lymphoprep separation, the HLA type and frozen in FCS with 10% DMSO. The protocol was approved by the Scientific Ethics Committee for the capital region of Denmark and carried out in accordance with the provisions of the Declaration of Helsinki. Written informed consent by patients was obtained prior to entering the study.
[0223] To identify the HLA-A2 restricted CTL epitopes for PD-L1, the amino acid sequence of PD-L1 was analyzed using the "Database SYFPEITHIP" (15) available on the internet. The 9mer (herein referred to as "PD-L101") is PDL115-23; (LLNAFTVTV) scored 30 by the SYFPEITHI algorithm and resulted as the best candidate epitope. The PD-L101 peptide and the two long PD-L1 polypeptides were produced; PDLong1: PDL19-28, FMTYWHLLNAFTVTVPKDL and PDLong2: PDL1242-264, VILGAILLCLGVALTFIFRLRKG. Only the first (PDLong1) included the PD-L101 sequence. High affinity HLA-A2 binding HIV-1 epitope pol476-484 (ILKEPVHGV) and CMV pp65 pos495-503 (NLVPMVATV) were used as irrelevant controls. ELISPOT TEST
[0224] In this study the ELISPOT was performed according to the rules provided by the CIP (http://cimt.eu/cimt/files/dl/cipguidelines.pdf). In some experiments PBMC was stimulated once in vitro with peptide prior to analysis as described to extend assay sensitivity. In summary, 96-well bottom plates with nitrocellulose (MultiScreen MAIP N45; Millipore) were coated overnight with relevant antibodies. Wells were washed, blocked by X-vivo medium and effector cells were added if possible in triplicate if not in duplicate at different cell concentrations, with or without peptide. Plates were incubated overnight. The next day, the medium was discarded and the wells were washed before addition of the relevant biotinylated secondary Ab (Mabtech), followed by the enzyme conjugated avidin (AP-Avidin; Calbiochem/Invitrogen Life Technologies) and finally the NBT/BCIP enzyme substrate (Invitrogen Life Technologies). Spots were counted using an ImmunoSpot Series 2.0 analyzer (CTL Analyzers). The definition of an ELISPOT response was based on the rules and recommendations provided by the CIP by an empirical or statistical approach; the first involves setting up a threshold to represent a biological response. This is supported by CIP rules suggesting that a threshold should be set to >6 specific spots per 100,000 PBMC. The non-parametric distribution-free resampling (DFR) test provides a way to formally compare antigen-stimulated wells with negative control wells. As a minimum the ELISPOT assay should be performed at least in triplet. In addition, the non-parametric unpaired Mann-Whitney test was used to compare PD-L101 specific responders between cancer patients and healthy donors. ESTABLISHMENT OF ANTIGEN-SPECIFIC T-CELL CULTURES
[0225] Two PD-L1 specific T cell cultures have been established. PBMC from breast cancer patient (CM.21) and melanoma patient (MM.05) were stimulated with autologous DC loaded with irradiated PD-L1. The next day IL-7 and IL-12 (PeproTech, London, UK) were added. Stimulation of cultures was performed every 8 days with autologous irradiated DC loaded with PD-L101 (2x) followed by autologous irradiated PBMC loaded with PD-101. The day after stimulation the IL-2 peptide (PeproTech, London, UK) was added. CD GENERATION
[0226] DC was generated from PBMC by adhering to culture dishes at 37°C for 1-2 hours in RPMI-1640. Adherent monocytes were cultured in RPMI-1640 supplemented with 10% fetal calf serum in the presence of IL-4 (250 U/ml) and GM-CSF (1000 U/ml) for 6 days. DC was matured by addition of IL-β (1000U/ml), IL-6 (1000U/ml) TNF-α (1000U/ml) and PGE2 (1 ug/ml). CYTOTOXITY TEST
[0227] Conventional 51Cr release assays for CTL-mediated cytotoxicity were performed as described in Andersen et al., J Immunol 1999. The target cells were T2 cells, transformed B cell lines EVB HLA-A2+ (KIG-BCL ), autologous matured DC (mDC), HLA-A2+ melanoma cell lines (MM1312.07 and MM.909.06) with or without IFN-y (100U/ml) addition for 2 days. T2 and KIG-BCL cells were pulsed with recombinant protein PD-L1 (Sino Biological Inc.) for 3 hours at 37°C before adding chromium. Lysis of T2 cells was blocked using an anti HLA-A2 FITC conjugated antibody (2ug/100ul, BD Biosciences). HLA AND ELISA PEPTIDE EXCHANGE TECHNOLOGY
[0228] To assess the affinity of the HLA peptide complex a UV exchange method was used in combination with a sandwich ELISA as described previously (19). Two strong binding peptides (HLA-A2/CMV pp65 pos495-503 (NLVPMVATV) and HLA-A2/1-11V-1 POL476-484 (I LKEPVHGV)) and a sample not exposed to UV light were used as positive controls, while a sample without peptide rescue was used as a negative control. Positive controls were done in quadruplicate and PD-L101 peptides in triplicate. siRNA-mediated PD-L1 MUTING
[0228] The siRNA double stealth to target PD-L1 silencing and the recommended siRNA double stealth negative control for the GC content medium were obtained from Invitrogen (Invitrogen, Paisley, UK). The siRNA PD-L1 double stealth consisted of the sense sequence 5'- CCUACUGGCAUUUGCUGAACGCAUU3' and the antisense sequence 5'- AAUGCGUUCAGCAAAUGCCAGUAGG-3'. For PD-L1 silencing experiments, mDC were transfected with PD-L1 siRNA using electroporation parameters. FLOW CYTOMETRY ANALYSIS
[0229] Flow cytometry analysis was performed on a FACSCANTO II (BD Biosciences, San Jose CA, USA) to determine a surface expression of PD-L1 on mDC before and after targeted siRNA silencing, T2 cells, KIG-BCL and the HLA-A2+ melanoma cell lines (MM1312.07 and MM.909.06) with or without IFN-Y treatment. Cells were washed in PBS/1% BSA and subsequently stained with either FITC- or PE-Cy5-conjugated anti PD-L1 monoclonal antibody for 30 min on ice in PBS/1% BSA. The non-reactive isotype-matched antibody (BD Biosciences) was used as a control. Fluorescence analyzes were performed using FACSDiva software (BD Biosciences) and FlowJo software (Tree Star, Ashland OR, USA). HLA MULTIMER STAINING
[0230] For a multimer/tetramer staining, tetramers coupled with PE and APC were prepared using an MHC peptide exchange technology. Staining was performed with CD3-AmCyan, CD8-Pacfic Blue, CD4-FITC (BD Bioscience) and the HLA-A2/PD-L101 (PDL115-23; LLNAFTVTV) or HIV-1 (pol476-484) HLA tetramer complexes; ILKEPVHGV) conjugated to APC/PE. Dead cell markers 7-AAD-PerCP (BD Bioscience) added prior to FACS analysis. For an enrichment the T cell cultures were stained with PE-conjugated HLA-A2/PD-L101 tetramer to and subsequently isolated with anti-PE microbeads (MACS Miltenyi Biotec).
[0231] In some experiments cells were stimulated with PD-L101 peptide (0.2mM) or an irrelevant HIV peptide and stained with CD107a-PE antibody (BD Biosciences) for 4 hours at 37°C. Subsequently, cells were stained with a tetramer and surface markers and analyzed with FACSCANTO II (BD Biosciences, San Jose CA, USA). RESULTS NATURAL T-CELL RESPONSES AGAINST PD-L1
[0232] The amino acid sequence of the PD-L1 protein was screened for the most likely deca-mer and ninth HLA-A2 peptide epitopes using the "SYFPEITHIP Database" available over the internet. Peptide PD-L115-23 (LLNAFTVTV) titled "PD-L101" came out as the best candidate with a predicative score of 30 and this peptide was subsequently synthesized. Peripheral blood mononuclear cells (PBMC) from healthy individuals as well as cancer patients were examined for the presence of specific T cell responses against this PD-L1-derived peptide using the IFN-Y ELISPOT secretion assay. The ELISPOT assay was previously used to identify new tumor antigens based on spontaneous immunity in cancer patients. Thus, HLA-A2+PBMC from patients with breast cancer, renal cell carcinoma or melanoma were stimulated once with PD-L101 in vitro prior to examination by ELISPOT. Frequent and strong responses were detected against PD-L101 in several patients. Figure 4A exemplifies PD-L101 specific T cell responses in one patient with renal cell carcinoma (RCC.46) and two patients with melanoma (MM.04 and MM.13). In general, the presence of PD-L1 reactive T cells in the blood of patients with HLA-A2+ cancer was revealed by IFN-y ELISPOT (Figure 4B). In addition, reactivity against PD-L1 was examined in PBMC from healthy individuals (Figure 4B). Although PD-L1 specific T cells can be found among healthy individuals, PBMC appears to be less frequent than in cancer patients, although a Mann-Whitney test illustrated that this difference did not reach complete significance (P = 0.06). In order to explain the data, eight responding patients are depicted in a bar in Figure 4C that the responses are compared to the background for each patient. The IFN-Y ELISPOT was performed only in duplicate to save material and the responses were therefore only considered by an empirical approach as suggested by the CIMT Immuno Guiding Program (CIP) rules. We further examined PBMC from patients responding to IFN-y from PD-L1 whether the PD-L101 specific cells still released the TNF-α cytokine. These experiments were performed in triplicate. It can be seen from Figure 4D that the natural PD-L101 specific cells in addition release TNF-α after stimulation with the PD-L1-derived epitope. In all eight patients the TNF-α response reached significance using a non-parametric distribution-free resampling (DFR) test.
[0233] We then examined the three patients responding for the presence of PD-L101 specific cells directly ex vivo without an in vitro peptide stimulation. A direct ELISPOT is exemplified in Figure 5A. While the frequency of PD-L1 reactive T cells is markedly increased by an in vitro stimulation, PD-L1 reactive T cells were readily detectable ex vivo in selected patients (Figure 5B).
[0234] PD-L101 was examined for its ability to bind HLA-A2 by comparison with two HLA-A2 restricted high affinity epitopes, ie HIV-1 pol476484 (ILKEPVHGV) and CMV pp65 pos495-503 (NLVPMVATV ) using a peptide exchange technology followed by ELISA.
[0235] PD-L101 bound to HLA-A2 comparable to the high-affinity control epitope (Figure 5C).
[0236] The high affinity binding of PD-L101 to HLA-A2 enables us to make stable HLA-A2/PDL101 tetramers, which were used to detect PDL1 reactive CTL by a flow cytometry. First, we stained PBMC from two patients responding to PD-L101 with the specific tetramer HLA-A2/PD-L101 directly ex vivo. These revealed PD-L1 reactive T cells were detectable ex vivo in both patients (Figure 5D). In both patients an in vitro peptide stimulation markedly increased the frequency of PD-L1 specific T cells. We then used PBMC from these cancer patients (CM.21 and MM.05) to generate T cell mass cultures against this peptide in vitro. Subsequently, in vitro stimulated PBMC from patients with autologous PDL101 pulsed CD. After three clear in vitro restimulations HLA-A2/PD-L101 positive T cells were detectable. 13.52% of PD-L1 tetramer positive cells are obtained using T cells from a patient with breast cancer and 0.17% of PD-L1 tetramer positive T cells are obtained using T cells from a patient with malignant melanoma (Figure 5D). PD-L1 SPECIFIC T CELLS ARE CTL
[0237] The cytolytic function of specific PD-L1 cultures were tested in standard 51Cr release assays using TAP-deficient T2 cells as target cells loaded with both PD-L101 and an irrelevant HIV control peptide. Figure 6A illustrates that T cell cultures of two lysed T2 cells from different patients pulsed with PD-L101 efficiently, whereas no cytotoxic was observed against T2 cells pulsed with the irrelevant peptide. Furthermore, we added both the PD-L101 and the irrelevant HIV peptide directly to the T cell mass culture and analyzed by a FACS. This revealed distinct populations of tetramers+HLA-A2/PD-L101, CD107a+ cells in cultures with added PD-L101 (Figure 6B)
[0238] We next examined whether PD-L101 specific T cells present among PBMC directly exhibited cytotoxic function. Thus, PBMC from three melanoma patients (MM.03, MM.53 and MM.135) all harboring T cells releasing IFN-y, specific PD-L101 were analyzed for further reactivity against PD-L101 using Granzyme B ( GrB) ELISPOT. Responses against PD-L101 could be detected in three patients (although only two reached significance) with a frequency of about 100-300 cells releasing PD-L101-specific GrB by 5x105 PBMC (Figure 6C). CYTOLOGICAL ACTIVITY AGAINST MELANONE PD-L1+ CELLS
[0239] We next examined the ability of the PD-L101-specific CTL to kill PD-L1+ melanoma cells MM1312.07 and MM.909.06. A PD-L101-specific CTL culture killed both cell lines, although MM1312.07 was only effectively killed in one effector to target the 30:1 ratio (Figure 7A). The CTL culture was highly specific for PDL101. PD-L1 expression by the two melanoma cell lines MM1312.07 and MM.909.06 were examined by FACS. Both cell lines expressed PD-L1, although only MM1312.07 exhibited very low expression. IFN-Y treatment increased PD-L1 expression in both cell lines (Figure 7B). In agreement with this, IFN-y treatment increased the inactivation of both melanoma cell lines (Figure 7A). To enhance the recognition inactivation of melanoma cells, we enriched the PD-L101 specific CTL using coupled HLA-A2/PD-L101 tetramer magnetic beads. The resulting CTL culture consisted of about 78% tetramer positive cells and killed the melanoma cell lines MM1312.07 and MM.909.06 with very high efficacy (Figure 7C). PD-L1 DEPENDENT LYSIS OF DENDRITIC CELLS
[0240] PD-L1 can be induced in immune cells. Thus, as the next and much more important step, we address the question whether mature DC expressing PD-L1 could also be susceptible to kill by PD-L1 reactive CTL. To test this notion, we generated an autologous DC from the same donors from which the CTL cultures had been generated; DC was matured by the addition of a standard maturation cocktail consisting of IL-1b, IL-6, TNF-α, and PGE2. We examined two different PD-L101 specific CTL cultures generated from two cancer patients (Figure 8A and 8B). Both CTL cultures effectively killed matured DC expressing PD-L1 (mDC) (Figure 8A and 8B). Additionally, using different concentrations of PD-L1 siRNA we down-regulated PD-L1 protein expression in autologous DC and rescued there the DC from being killed by PD-L1 specific CTL cultures (Figure 8A and 8B). As a control mDC was transfected with a siRNA negative control GC medium. These DC were killed by both PD-L101 specific T cell cultures (Figure 8A and 8B). The percentage of PD-L101 tetramer positive cells among T cell cultures killing mDC was assessed by a tetramer stain. The HLA-A2/PD-L101-PE/APC and HLA-A2/HIVPE/APC tetramer complexes were used. 46.92% and 71.69% of PD-L101 tetramer positive cells among T cell cultures killing mDC were identified (Figure 8A and 8B respectively). To validate the unexpected of PD-L1 at the protein level, we analyzed PD-L1 surface expression in mDC 24 hours after siRNA transfection (Figure 8C). These stains confirmed that the use of PD-L1 siRNA reduced the level of PD-L1 protein expression in cells (Figure 8C) in a concentration-dependent manner. Notably, the effectiveness of inactivation correlated with the amount of PD-L1 expressed by DC. INDEPENDENT CROSS PRESENTATION OF PD-L1 TAP BY NON-PROFESSIONAL ANTIGEN PRESENTING CELLS
[0241] We analyzed two long PD-L1 polypeptides; PDL19-28 (FMTYWHLLNAFTVTVPKDL) entitled "PDLong1" and PDL1242-264 (VILGAILLCLGVALTFIFRLRKG) entitled "PDLong2". Only the first (PDLong1) included the PD-L101 sequence (PDL115-23; LLNAFTVTV). The PD-L101 specific CTL was tested against EBV transformed B cell line HLA-A2+ KIG-BCL pulsed with PD-L101, PDLong1, PDLong2 or an irrelevant HIV peptide. B cells pulsed not only with the minimal PD-L101 peptide, but in addition with the PDLong1 peptide were recognized by the PD-L101-specific CTL, whereas the B cells pulsed with both the HIV control peptides and PDLong2 were not dead (Figure 9A). KIG-BCL cells did not express PD-L1 (Figure 9D). Similarly, we examined the cells' capacity for the long PD-L1 peptide. Thus, the PD-L101 specific CTL was tested against T2 cells pulsed with PD-L101, PDLong1, PDLong2 or the HIV peptide. Despite the absence of TAP transporters in T2 cells, the PDL01 peptide was effectively presented by T2 cells as they were killed by the specific CTL PD-L101 (Figure 9B). Inactivation was restricted to HLA-A2, as it could be blocked by the addition of anti-HLA-A2 antibodies (Figure 9C). T2 cells did not express PD-L1 (Figure 9D). Finally, we assessed whether the PD-L101 specific CTL recognized T2 or KIG-BCL cells pulsed with a full-length protein for at least 3 hours. KIG-BCL was apparently not able to appear cross-linked to the full-length protein, as these cells were not recognized (Figure 9). Surprisingly, however, T cells pulsed with the full-length protein were recognized and killed by the PD-L101-specific CTL (Figure 9B). In this way, T2 cells were able not only to take over, process and present PDLong1, but also the full-length recombinant PD-L1 protein. EXAMPLE 4
[0242] To investigate whether costimulation with PD-L1 peptide would boost T cell reactivity against tumor associated antigens and viral any of the following experiments were performed. CO-CULTURE WITH AUTOLOGOUS PD-L1 SPECIFIC T CELLS
[0243] PBMC were stimulated in vitro with 50 µg/ml of viral peptide (CMV pp65495-503 NLVPMVATV), CMV IE1 316-324 (VLEETSVML) or Flu matrix p58-66 (GILGFVFTL)). 40 U/ml IL-2 was added on day 2 and 6. PBMC was either cultured alone or added to autologous PD-L1 specific T cells (in a PBMC to a PD-L1 specific T cell ratio of 2000:1 ) on day 6. On day 9, cultures were stimulated with 120 U/ml IL-2. After 12 days in culture, the number of virus-specific T cells in the cultures, either grown alone or added to PD-L1 specific T cells, were compared by an MHC tetramer stain. The number of Tregs, IL-17A producing T cells and the proportion of CD4/CD8 cells in the cultures were also compared. As a control, PBMC was co-cultured with autologous CD8+ T cells of irrelevant specificity. CO-STIMULATION WITH PD-L1 PEPTIDE
[0244] PBMC were stimulated in vitro with 25 μg/ml of tumor associated antigen or virus (CMV pp65465-563 (NI-VPMVATV), CMV IE1316-324 (VLEETSVML), or MART-126-35 (EAAGIGILTV)), either in co-culture with 25 µg/ml of PD-L1 peptide or an irrelevant peptide (HIV-1 pol476-484 (ILKEPVHGV)). 40 U/ml IL-2 was added every three days. Every seven days, cultures were stimulated with a mixture of CMV- or MART-1 peptide plus a PD-L1 peptide, or a mixture of CMV or MART-1 peptide plus HIV-1 peptide pol476-484, respectively. Cells were stimulated with peptides diluted 10-, 100-, and 1000-fold for the second, third, and fourth peptide stimulation, respectively. After three or four stimulations, the number of CMV- or MART-1 specific T cells in the cultures, either co-cultured with PD-L1 peptide or HIV-1 peptide pol476-484, was compared by HC tetramer staining. The number of Tregs, IL-17A producing T cells and the proportion of CD4/CD8 cells in the cultures were also compared.

权利要求:
Claims (7)
[0001]
1. Vaccine composition CHARACTERIZED in that it comprises: a) an immunologically active peptide fragment comprising a consecutive sequence of at least 8 amino acids from PD-L1 of SEQ ID NO: 1 and comprising the sequence of any one of SEQ ID NOs: 2, 3, 4, 12 or 15, or the sequence of VILGAILLCLGVALTFIFRLRKG; and b) an adjuvant.
[0002]
2. Vaccine composition according to claim 1, CHARACTERIZED by the fact that the immunologically active peptide fragment consists of a maximum of 50 amino acid residues, for example, a maximum of 45 amino acid residues, such as a maximum of 40 amino acid residues. amino acids, for example, at most 35 amino acid residues, such as at most 30 amino acid residues, for example, at most 25 amino acid residues, such as 20 to 25 amino acid residues.
[0003]
3. Vaccine composition, according to claim 1 or 2, CHARACTERIZED by the fact that said immunologically active peptide fragment comprises the sequence FMTYWHLLNAFTVTVPKDL.
[0004]
4. Vaccine composition according to any one of claims 1 to 3, CHARACTERIZED by the fact that the adjuvant is selected from the group consisting of adjuvants based on bacterial DNA, adjuvants based on oil/surfactant, adjuvants based in viral dsRNA and imidazoquinillines.
[0005]
5. Vaccine composition, according to any one of claims 1 to 4, CHARACTERIZED by the fact that the vaccine composition comprises antigen-presenting cells comprising the immunologically active peptide fragment or a nucleic acid encoding said peptide fragment immunologically active.
[0006]
6. Kit of parts CHARACTERIZED by the fact that it comprises: a) the vaccine composition, as defined in any one of claims 1 to 5; and b) a composition comprising at least one immunostimulating antibody.
[0007]
7. Use of the vaccine composition, as defined in any one of claims 1 to 5, or kit of parts, as defined in claim 6, CHARACTERIZED by the fact that it is for the manufacture of a drug for the treatment or prevention of cancer , which expresses PD-L1.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112014009526B1|2021-07-13|VACCINE COMPOSITION INCLUDING PD-L1, KIT OF PARTS INCLUDING SUCH COMPOSITION AND USE OF THE SAME TO TREAT OR PREVENT CANCER

---

US10258678B2|2019-04-16|Indoleamine 2,3-dioxygenase based immunotherapy

---

US20210023191A1|2021-01-28|Vaccine compositions comprising tryptophan 2,3-dioxygenase or fragments thereof

---

US20190008939A1|2019-01-10|Vaccine compositions comprising c-c motif chemokine 22 | or fragments thereof

同族专利:

---

公开号 | 公开日

---

CN103917243B|2021-05-11|

---

JP6259763B2|2018-01-10|

---

US20140242101A1|2014-08-28|

---

EP2768524A1|2014-08-27|

---

CN103917243A|2014-07-09|

---

CA2850245C|2020-04-28|

---

BR112014009526A2|2017-05-09|

---

US9669078B2|2017-06-06|

---

WO2013056716A1|2013-04-25|

---

CN113444165A|2021-09-28|

---

JP2014534202A|2014-12-18|

---

CA2850245A1|2013-04-25|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US58767A|1866-10-16|John brougjbton |

---

US5554372A|1986-09-22|1996-09-10|Emory University|Methods and vaccines comprising surface-active copolymers|

---

US6096313A|1996-02-09|2000-08-01|Ludwig Institute For Cancer Research|Compositions containing immunogenic molecules and granulocyte-macrophage colony stimulating factor, as an adjuvant|

---

AU1448701A|1999-11-09|2001-06-06|Human Genome Sciences, Inc.|15 human secreted proteins|

---

WO2002079499A1|2001-04-02|2002-10-10|Wyeth|Pd-1, a receptor for b7-4, and uses therefor|

---

WO2002086083A2|2001-04-20|2002-10-31|Mayo Foundation For Medical Education And Research|Methods of enhancing cell responsiveness|

---

EP2206517A1|2002-07-03|2010-07-14|Ono Pharmaceutical CO., LTD.|Immunopotentiating compositions comprising anti-PD-L1 antibodies|

---

US20090304711A1|2006-09-20|2009-12-10|Drew Pardoll|Combinatorial Therapy of Cancer and Infectious Diseases with Anti-B7-H1 Antibodies|

---

WO2009026472A1|2007-08-21|2009-02-26|The General Hospital Corporation|Methods for inducing tolerance|

---

CN102203125A|2008-08-25|2011-09-28|安普利穆尼股份有限公司|Pd-1 antagonists and methods of use thereof|

---

JP2013512251A|2009-11-24|2013-04-11|アンプリミューン、インコーポレーテッド|Simultaneous inhibition of PD-L1 / PD-L2|

---

PL2542590T5|2010-03-05|2020-08-10|The Johns Hopkins University|Compositions and methods for targeted immunomodulatory antibodies and fusion proteins|TWI676636B|2013-07-12|2019-11-11|Ｖｌｐ醫療股份有限公司|Virus like particle comprising pd-1 antigen or pd-1 ligand antigen|

---

US10816554B2|2014-04-04|2020-10-27|The Board Of Trustees Of The Leland Stanford Junior University|Ligand discovery for T cell receptors|

---

EP3195168A4|2014-07-31|2018-07-25|The University Of Western Australia|A method for the identification of immunotherapy-drug combinations using a network approach|

---

EP3193917B9|2014-09-17|2022-02-16|IO Biotech ApS|Vaccine compositions comprising tryptophan 2,3-dioxygenase or fragments thereof|

---

JP6918333B2|2014-09-17|2021-08-11|学校法人近畿大学|Peptides recognized by cell-mediated immunity and pharmaceuticals using them|

---

ES2790823T3|2014-11-14|2020-10-29|Liquid Genomics Inc|Use of circulating cell-free RNA for cancer diagnosis and / or monitoring|

---

JP6535133B2|2015-05-15|2019-06-26|リーバー ジェネティクス シーオー．， エルティーディー．Ｒｅｂｅｒ Ｇｅｎｅｔｉｃｓ Ｃｏ．， Ｌｔｄ．|Novel baculovirus vector and method of use|

---

CA2998789A1|2015-09-16|2017-03-23|Herlev Hospital|Vaccine compositions comprising c-c motif chemokine 22or fragments thereof|

---

EP3423087A1|2016-03-04|2019-01-09|IO Biotech APS|Combination therapy against cancer|

---

CA3016474A1|2016-03-15|2017-09-21|Mersana Therapeutics, Inc.|Napi2b-targeted antibody-drug conjugates and methods of use thereof|

---

WO2017211371A2|2016-06-10|2017-12-14|Herlev Hospital|Calr and jak2 vaccine compositions|

---

JP2019527676A|2016-06-21|2019-10-03|アイオー バイオテック エーピーエスＩＯ Ｂｉｏｔｅｃｈ ＡｐＳ|PDL1 peptide for use in cancer vaccines|

---

EP3478321A4|2016-06-30|2020-04-22|Oncorus, Inc.|Pseudotyped oncolytic viral delivery of therapeutic polypeptides|

---

US11135307B2|2016-11-23|2021-10-05|Mersana Therapeutics, Inc.|Peptide-containing linkers for antibody-drug conjugates|

---

US20190381157A1|2017-01-29|2019-12-19|Zequn Tang|Methods of immune modulation against foreign and/or auto antigens|

---

CN108503691B|2017-02-25|2021-07-23|复旦大学|High-affinity peptide of human PD-L1 protein and application thereof|

---

TW201834697A|2017-02-28|2018-10-01|美商梅爾莎納醫療公司|Combination therapies of her2-targeted antibody-drug conjugates|

---

KR20190125481A|2017-03-17|2019-11-06|백심 아게|New PD-L1 Targeting DNA Vaccine for Immunotherapeutic in Cancer|

---

EP3717021A1|2017-11-27|2020-10-07|Mersana Therapeutics, Inc.|Pyrrolobenzodiazepine antibody conjugates|

---

WO2019126691A1|2017-12-21|2019-06-27|Mersana Therapeutics, Inc.|Pyrrolobenzodiazepine antibody conjugates|

---

FR3086534B1|2018-10-01|2020-11-06|Univ Bordeaux|METHOD FOR TREATING INFECTION WITH HUMAN IMMUNODEFICIENCY VIRUS|

---

WO2020092385A1|2018-10-29|2020-05-07|Mersana Therapeutics, Inc.|Cysteine engineered antibody-drug conjugates with peptide-containing linkers|

---

CN109593135B|2018-12-29|2021-01-15|百奥赛图江苏基因生物技术有限公司|Anti-human PD-L1 monoclonal antibody and application thereof|

---

WO2020181402A1|2019-03-10|2020-09-17|胡西木|Anti-tumor polypeptides and use therefor|

---

CN113249447A|2019-04-26|2021-08-13|嘉兴允英医学检验有限公司|Method and kit for detecting expression level of PD-L1|

---

WO2021055583A1|2019-09-17|2021-03-25|Ohio State Innovation Foundation|Human anti-pd-l1 peptide vaccines and methods of their use|

---

WO2021208106A1|2020-04-18|2021-10-21|北京泽勤生物医药有限公司|Fusion peptide for treating autoimmune disease|

法律状态:
2018-01-16| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|

---

2018-03-27| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2019-05-21| B07E| Notice of approval relating to section 229 industrial property law [chapter 7.5 patent gazette]|Free format text: NOTIFICACAO DE ANUENCIA RELACIONADA COM O ART 229 DA LPI |

---

2019-08-20| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2021-01-12| B07A| Application suspended after technical examination (opinion) [chapter 7.1 patent gazette]|

---

2021-05-04| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2021-07-13| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 17/10/2012, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

DKPA201170574|2011-10-17|

---

DKPA201170574|2011-10-17|

---

PCT/DK2012/050386|WO2013056716A1|2011-10-17|2012-10-17|Pd-l1 based immunotherapy|

---